Incidental Mutation 'R3622:Snrpb'
ID268656
Institutional Source Beutler Lab
Gene Symbol Snrpb
Ensembl Gene ENSMUSG00000027404
Gene Namesmall nuclear ribonucleoprotein B
SynonymsSNRNP-B, SM-B, SMB, SM11
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130171414-130179403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 130175379 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 73 (R73L)
Ref Sequence ENSEMBL: ENSMUSP00000099488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103199] [ENSMUST00000147570]
Predicted Effect probably null
Transcript: ENSMUST00000103199
AA Change: R73L

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099488
Gene: ENSMUSG00000027404
AA Change: R73L

DomainStartEndE-ValueType
Sm 7 82 1.06e-24 SMART
low complexity region 98 117 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 169 229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139225
Predicted Effect probably benign
Transcript: ENSMUST00000147570
SMART Domains Protein: ENSMUSP00000143633
Gene: ENSMUSG00000027404

DomainStartEndE-ValueType
Sm 7 64 6.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150835
Meta Mutation Damage Score 0.9447 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several nuclear proteins that are found in common among U1, U2, U4/U6, and U5 small ribonucleoprotein particles (snRNPs). These snRNPs are involved in pre-mRNA splicing, and the encoded protein may also play a role in pre-mRNA splicing or snRNP structure. Autoantibodies from patients with systemic lupus erythematosus frequently recognize epitopes on the encoded protein. Two transcript variants encoding different isoforms (B and B') have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Snrpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Snrpb APN 2 130175331 missense probably benign 0.29
R3624:Snrpb UTSW 2 130175379 missense probably null 0.87
R5905:Snrpb UTSW 2 130179276 start gained probably benign
R7574:Snrpb UTSW 2 130177019 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACTCACTGGCAAGGTAGCTG -3'
(R):5'- TGGCTTGGTAGGAAACAGCTATC -3'

Sequencing Primer
(F):5'- CTCACTGGCAAGGTAGCTGTTTTAAG -3'
(R):5'- ATCACTTAGCCTGGGGTACTGAC -3'
Posted On2015-02-19