Incidental Mutation 'R3622:Vmn2r116'
ID 268688
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R3622 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 23384803-23401864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23386051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 113 (S113G)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect probably benign
Transcript: ENSMUST00000164856
AA Change: S113G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: S113G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
R8950:Vmn2r116 UTSW 17 23401493 missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23386942 missense possibly damaging 0.56
R9030:Vmn2r116 UTSW 17 23384890 missense possibly damaging 0.82
R9077:Vmn2r116 UTSW 17 23385982 missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23401167 missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23401592 missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23386945 missense probably benign 0.01
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAATCCAGTGCAGATTTGTCC -3'
(R):5'- AAGGTCATGCTGGCACTAGAG -3'

Sequencing Primer
(F):5'- GCAGATTTGTCCATTTATTGACTGC -3'
(R):5'- TCATGCTGGCACTAGAGATACATG -3'
Posted On 2015-02-19