Incidental Mutation 'R3622:Plin4'
ID268690
Institutional Source Beutler Lab
Gene Symbol Plin4
Ensembl Gene ENSMUSG00000002831
Gene Nameperilipin 4
SynonymsS3-12
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56100591-56109803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56104112 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 973 (T973K)
Ref Sequence ENSEMBL: ENSMUSP00000139859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002908] [ENSMUST00000002911] [ENSMUST00000190703] [ENSMUST00000225843] [ENSMUST00000226053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002908
AA Change: T973K

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002908
Gene: ENSMUSG00000002831
AA Change: T973K

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
low complexity region 1124 1136 N/A INTRINSIC
Pfam:Perilipin 1144 1385 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002911
SMART Domains Protein: ENSMUSP00000002911
Gene: ENSMUSG00000002833

DomainStartEndE-ValueType
PWWP 5 62 1.78e-19 SMART
low complexity region 90 109 N/A INTRINSIC
low complexity region 127 136 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 181 196 N/A INTRINSIC
low complexity region 212 243 N/A INTRINSIC
low complexity region 252 272 N/A INTRINSIC
low complexity region 273 300 N/A INTRINSIC
low complexity region 301 311 N/A INTRINSIC
coiled coil region 321 364 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
Pfam:LEDGF 468 569 2.8e-31 PFAM
internal_repeat_1 575 644 2.5e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000190703
AA Change: T973K

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139859
Gene: ENSMUSG00000002831
AA Change: T973K

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
internal_repeat_2 74 335 9.44e-7 PROSPERO
internal_repeat_1 103 467 2.72e-12 PROSPERO
internal_repeat_2 343 701 9.44e-7 PROSPERO
internal_repeat_1 598 1090 2.72e-12 PROSPERO
Pfam:Perilipin 1110 1385 1.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225731
Predicted Effect probably benign
Transcript: ENSMUST00000225843
Predicted Effect probably benign
Transcript: ENSMUST00000226053
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the perilipin family, such as PLIN4, coat intracellular lipid storage droplets (Wolins et al., 2003 [PubMed 12840023]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased triglyceride in the heart and protection from cardiac steatosis induced by prolonged fasting, feeding or genetic obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Plin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01685:Plin4 APN 17 56107362 missense probably damaging 0.98
IGL02121:Plin4 APN 17 56102131 missense probably damaging 0.98
IGL02254:Plin4 APN 17 56104733 missense probably damaging 0.98
IGL02539:Plin4 APN 17 56106680 missense probably damaging 1.00
IGL02892:Plin4 APN 17 56105108 missense probably damaging 1.00
IGL03051:Plin4 APN 17 56105417 missense possibly damaging 0.91
IGL03258:Plin4 APN 17 56104371 missense probably benign 0.05
PIT4519001:Plin4 UTSW 17 56103828 missense probably benign 0.23
R0211:Plin4 UTSW 17 56102242 missense probably damaging 1.00
R0365:Plin4 UTSW 17 56104667 missense possibly damaging 0.93
R0545:Plin4 UTSW 17 56106567 missense probably damaging 1.00
R0551:Plin4 UTSW 17 56106756 missense probably benign 0.03
R0862:Plin4 UTSW 17 56103966 missense probably benign 0.00
R0864:Plin4 UTSW 17 56103966 missense probably benign 0.00
R1260:Plin4 UTSW 17 56104348 nonsense probably null
R1650:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1688:Plin4 UTSW 17 56109363 missense possibly damaging 0.61
R1725:Plin4 UTSW 17 56106473 missense probably damaging 1.00
R1803:Plin4 UTSW 17 56104931 missense probably damaging 0.99
R1834:Plin4 UTSW 17 56103522 missense probably damaging 0.97
R1953:Plin4 UTSW 17 56103849 missense possibly damaging 0.49
R2860:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2861:Plin4 UTSW 17 56106668 missense probably damaging 0.98
R2915:Plin4 UTSW 17 56104389 missense probably damaging 0.98
R3438:Plin4 UTSW 17 56107193 missense probably benign 0.26
R3932:Plin4 UTSW 17 56106704 missense probably benign 0.01
R4116:Plin4 UTSW 17 56102113 missense probably benign 0.30
R4201:Plin4 UTSW 17 56104338 missense probably damaging 1.00
R4529:Plin4 UTSW 17 56104274 missense probably damaging 1.00
R4610:Plin4 UTSW 17 56105418 missense probably benign 0.08
R4692:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4693:Plin4 UTSW 17 56103762 missense probably damaging 1.00
R4718:Plin4 UTSW 17 56106981 missense possibly damaging 0.46
R5283:Plin4 UTSW 17 56106777 missense probably benign 0.00
R5304:Plin4 UTSW 17 56106132 missense probably benign 0.00
R5333:Plin4 UTSW 17 56104970 missense probably benign 0.31
R5484:Plin4 UTSW 17 56104932 missense possibly damaging 0.90
R5569:Plin4 UTSW 17 56102147 missense probably benign 0.02
R5765:Plin4 UTSW 17 56102470 missense possibly damaging 0.68
R5776:Plin4 UTSW 17 56104983 missense probably damaging 0.99
R5828:Plin4 UTSW 17 56107064 missense probably damaging 0.99
R5932:Plin4 UTSW 17 56106356 missense possibly damaging 0.92
R5988:Plin4 UTSW 17 56109567 missense probably benign 0.03
R6053:Plin4 UTSW 17 56108618 missense probably benign 0.01
R6264:Plin4 UTSW 17 56104787 missense possibly damaging 0.90
R6334:Plin4 UTSW 17 56103261 missense probably benign 0.22
R6415:Plin4 UTSW 17 56103264 missense probably damaging 1.00
R7030:Plin4 UTSW 17 56103969 missense probably damaging 1.00
R7302:Plin4 UTSW 17 56102330 missense probably benign 0.00
R7342:Plin4 UTSW 17 56104608 missense probably benign 0.01
R7352:Plin4 UTSW 17 56104427 missense probably benign 0.16
R7354:Plin4 UTSW 17 56104427 missense probably benign 0.16
R7505:Plin4 UTSW 17 56109357 missense possibly damaging 0.56
R7540:Plin4 UTSW 17 56104883 missense probably damaging 0.96
R7570:Plin4 UTSW 17 56106776 missense probably benign 0.00
R7685:Plin4 UTSW 17 56102413 missense probably benign 0.02
R7699:Plin4 UTSW 17 56103828 missense probably benign 0.01
R8165:Plin4 UTSW 17 56107019 missense possibly damaging 0.92
R8309:Plin4 UTSW 17 56104437 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGACAGTGTCCTTCATGCC -3'
(R):5'- CCAAGTCTGTGCTCATGGGTAC -3'

Sequencing Primer
(F):5'- CAGACAGTGTCCTTCATGCCTATAAG -3'
(R):5'- TCTGTGCTCATGGGTACAAAGGAC -3'
Posted On2015-02-19