Incidental Mutation 'R3622:Srsf9'
ID268665
Institutional Source Beutler Lab
Gene Symbol Srsf9
Ensembl Gene ENSMUSG00000029538
Gene Nameserine/arginine-rich splicing factor 9
SynonymsSfrs9, 2610029M16Rik, SRp30c
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115327177-115333080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115330512 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 69 (A69V)
Ref Sequence ENSEMBL: ENSMUSP00000031513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031513] [ENSMUST00000139167] [ENSMUST00000149510]
PDB Structure
Solution structure of RRM domain in protein BAB31986 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000031513
AA Change: A69V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031513
Gene: ENSMUSG00000029538
AA Change: A69V

DomainStartEndE-ValueType
RRM 16 86 3.76e-19 SMART
RRM 113 179 1.19e-7 SMART
low complexity region 187 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139167
SMART Domains Protein: ENSMUSP00000115090
Gene: ENSMUSG00000029536

DomainStartEndE-ValueType
Pfam:Glu-tRNAGln 69 134 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144000
Predicted Effect probably benign
Transcript: ENSMUST00000149510
SMART Domains Protein: ENSMUSP00000121845
Gene: ENSMUSG00000029538

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
RRM 54 115 3.04e-2 SMART
low complexity region 123 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209604
Meta Mutation Damage Score 0.6753 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Srsf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Srsf9 APN 5 115332128 missense probably damaging 1.00
R0137:Srsf9 UTSW 5 115332201 missense possibly damaging 0.64
R0603:Srsf9 UTSW 5 115332637 missense probably damaging 0.99
R1565:Srsf9 UTSW 5 115327370 missense possibly damaging 0.73
R1781:Srsf9 UTSW 5 115327422 nonsense probably null
R2942:Srsf9 UTSW 5 115332693 missense probably damaging 1.00
R3689:Srsf9 UTSW 5 115327328 missense probably benign 0.00
R4492:Srsf9 UTSW 5 115332592 missense probably damaging 1.00
R5345:Srsf9 UTSW 5 115330536 missense probably benign 0.03
R5840:Srsf9 UTSW 5 115331465 missense probably benign
R6355:Srsf9 UTSW 5 115327309 start codon destroyed probably null 0.04
R7207:Srsf9 UTSW 5 115327422 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCCCAGCTGTCAAACTTTG -3'
(R):5'- ACACTTCCTTGAAGGCTAGACTC -3'

Sequencing Primer
(F):5'- ACTTTGAGTAATGTGAACGGCCC -3'
(R):5'- ACTCTCGTTCAGCAAAGTGG -3'
Posted On2015-02-19