Incidental Mutation 'R3706:Sgo2b'
ID271774
Institutional Source Beutler Lab
Gene Symbol Sgo2b
Ensembl Gene ENSMUSG00000094443
Gene Nameshugoshin 2B
SynonymsSgol2b, Gm4975
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location63924694-63952248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63928145 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 551 (E551G)
Ref Sequence ENSEMBL: ENSMUSP00000136323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179944]
Predicted Effect probably damaging
Transcript: ENSMUST00000179944
AA Change: E551G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: E551G

DomainStartEndE-ValueType
coiled coil region 54 113 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
internal_repeat_1 528 618 9.12e-8 PROSPERO
internal_repeat_1 713 809 9.12e-8 PROSPERO
low complexity region 1009 1024 N/A INTRINSIC
low complexity region 1059 1081 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1130 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210915
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Rab11b G C 17: 33,747,766 H162D probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Sgo2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sgo2b APN 8 63926523 missense probably benign
IGL01343:Sgo2b APN 8 63927315 nonsense probably null
IGL02027:Sgo2b APN 8 63926829 missense probably benign
IGL02090:Sgo2b APN 8 63927089 missense probably damaging 0.99
IGL02121:Sgo2b APN 8 63931282 missense possibly damaging 0.94
IGL02206:Sgo2b APN 8 63941084 missense possibly damaging 0.94
IGL02554:Sgo2b APN 8 63926537 missense probably damaging 0.96
IGL02663:Sgo2b APN 8 63943114 missense probably damaging 0.97
IGL03149:Sgo2b APN 8 63926583 missense probably benign 0.14
floater UTSW 8 63938417 nonsense probably null
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0201:Sgo2b UTSW 8 63926636 missense probably benign
R0285:Sgo2b UTSW 8 63928789 nonsense probably null
R0325:Sgo2b UTSW 8 63928376 missense probably benign 0.20
R0727:Sgo2b UTSW 8 63927782 missense probably damaging 0.98
R0943:Sgo2b UTSW 8 63931335 missense possibly damaging 0.82
R1148:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1266:Sgo2b UTSW 8 63928421 missense probably benign 0.00
R1484:Sgo2b UTSW 8 63931473 missense possibly damaging 0.77
R1493:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1537:Sgo2b UTSW 8 63926502 missense possibly damaging 0.94
R1630:Sgo2b UTSW 8 63927797 missense possibly damaging 0.90
R1803:Sgo2b UTSW 8 63927392 missense probably benign 0.01
R1912:Sgo2b UTSW 8 63931469 missense probably damaging 0.98
R1993:Sgo2b UTSW 8 63926833 missense probably benign 0.36
R2042:Sgo2b UTSW 8 63928527 missense probably benign
R2130:Sgo2b UTSW 8 63927147 missense probably benign 0.09
R2146:Sgo2b UTSW 8 63928023 missense probably benign 0.00
R2881:Sgo2b UTSW 8 63927536 missense probably damaging 0.99
R3686:Sgo2b UTSW 8 63931327 missense probably benign 0.20
R3889:Sgo2b UTSW 8 63927743 missense possibly damaging 0.82
R3894:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R3895:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R4058:Sgo2b UTSW 8 63926947 missense probably damaging 0.98
R4259:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4260:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4704:Sgo2b UTSW 8 63927790 missense probably damaging 0.98
R4815:Sgo2b UTSW 8 63931414 missense probably benign
R4922:Sgo2b UTSW 8 63926630 missense possibly damaging 0.66
R5232:Sgo2b UTSW 8 63928602 missense possibly damaging 0.55
R5262:Sgo2b UTSW 8 63943137 missense probably damaging 0.99
R5444:Sgo2b UTSW 8 63926556 missense possibly damaging 0.90
R5677:Sgo2b UTSW 8 63926974 missense possibly damaging 0.77
R5959:Sgo2b UTSW 8 63927288 missense probably benign 0.01
R6004:Sgo2b UTSW 8 63926673 nonsense probably null
R6267:Sgo2b UTSW 8 63927793 missense probably benign
R6296:Sgo2b UTSW 8 63927793 missense probably benign
R6328:Sgo2b UTSW 8 63928311 nonsense probably null
R6517:Sgo2b UTSW 8 63931494 missense probably damaging 0.99
R6523:Sgo2b UTSW 8 63927504 missense probably benign 0.11
R6726:Sgo2b UTSW 8 63927735 nonsense probably null
R6957:Sgo2b UTSW 8 63931455 small deletion probably benign
R7031:Sgo2b UTSW 8 63940044 missense possibly damaging 0.94
R7034:Sgo2b UTSW 8 63926834 missense probably benign 0.36
R7145:Sgo2b UTSW 8 63928184 missense probably damaging 1.00
R7289:Sgo2b UTSW 8 63941158 missense probably damaging 0.97
R7366:Sgo2b UTSW 8 63938417 nonsense probably null
R7660:Sgo2b UTSW 8 63940074 missense probably benign 0.27
R7761:Sgo2b UTSW 8 63926912 missense probably benign
R7762:Sgo2b UTSW 8 63926497 missense probably benign 0.03
R7822:Sgo2b UTSW 8 63927284 missense probably damaging 0.98
R8111:Sgo2b UTSW 8 63943104 missense probably damaging 0.98
R8129:Sgo2b UTSW 8 63928800 missense possibly damaging 0.90
RF014:Sgo2b UTSW 8 63931405 missense possibly damaging 0.94
RF055:Sgo2b UTSW 8 63943169 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63927005 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63928422 missense possibly damaging 0.61
Z1177:Sgo2b UTSW 8 63927439 missense probably benign 0.03
Z1177:Sgo2b UTSW 8 63928385 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTTTGGAAGGGAAAGTTGCC -3'
(R):5'- AGGAAGCAAACCCTTTCTCCAG -3'

Sequencing Primer
(F):5'- GCCTTTTTCTAGGAAGTGCATATC -3'
(R):5'- AACCCTTTCTCCAGACATTCAG -3'
Posted On2015-03-25