Incidental Mutation 'R6296:Sgo2b'
ID 508769
Institutional Source Beutler Lab
Gene Symbol Sgo2b
Ensembl Gene ENSMUSG00000094443
Gene Name shugoshin 2B
Synonyms Sgol2b, Gm4975
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R6296 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 63924694-63952248 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 63927793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 668 (M668I)
Ref Sequence ENSEMBL: ENSMUSP00000136323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179944]
AlphaFold J3QMK1
Predicted Effect probably benign
Transcript: ENSMUST00000179944
AA Change: M668I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136323
Gene: ENSMUSG00000094443
AA Change: M668I

DomainStartEndE-ValueType
coiled coil region 54 113 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
internal_repeat_1 528 618 9.12e-8 PROSPERO
internal_repeat_1 713 809 9.12e-8 PROSPERO
low complexity region 1009 1024 N/A INTRINSIC
low complexity region 1059 1081 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1130 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210915
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
5730559C18Rik C T 1: 136,221,071 probably null Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Adcy5 A G 16: 35,303,710 Y1253C probably damaging Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Adm A G 7: 110,628,354 T26A probably benign Het
Ahnak T G 19: 9,003,305 V651G probably damaging Het
Akr7a5 G A 4: 139,318,221 V358I probably benign Het
Ankar T G 1: 72,643,258 T1383P probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cacna1h G A 17: 25,383,079 R1596C probably damaging Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Cfap54 T C 10: 93,066,846 Y148C probably damaging Het
Coa5 A G 1: 37,428,347 S60P probably damaging Het
Col6a2 T C 10: 76,611,049 N342D probably damaging Het
Cyp2c29 T G 19: 39,330,261 I434S possibly damaging Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dusp16 C A 6: 134,720,493 probably null Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Epn1 G A 7: 5,090,123 A145T probably damaging Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Gm6358 T C 16: 89,141,082 S70P unknown Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hsfy2 T A 1: 56,637,192 H62L probably benign Het
Ighm T C 12: 113,421,567 I258V unknown Het
Igkv13-71-1 G T 6: 69,235,799 noncoding transcript Het
Irx1 A C 13: 71,959,668 S298R probably damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kcnc1 G A 7: 46,435,316 A555T probably benign Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lipo1 T C 19: 33,780,337 D244G probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Macf1 A T 4: 123,432,875 I4943N probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr209 T C 16: 59,361,406 K271E probably benign Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pbx1 T C 1: 168,183,615 D372G possibly damaging Het
Pikfyve T A 1: 65,262,953 S1668T probably damaging Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Plag1 G T 4: 3,904,499 H231N probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Ptpn23 A T 9: 110,393,826 N54K probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rassf9 T A 10: 102,545,753 I332N probably damaging Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rnf214 A G 9: 45,867,821 S389P probably benign Het
Rxfp1 A C 3: 79,667,848 L181R probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sh3bp4 C A 1: 89,145,489 S686R probably damaging Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stard13 A T 5: 151,062,673 S339R probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tinag T A 9: 76,996,935 E402V possibly damaging Het
Tmem183a T C 1: 134,361,611 D27G probably damaging Het
Tnfrsf13c T C 15: 82,223,902 T56A probably damaging Het
Tnrc18 A C 5: 142,733,576 L1985R unknown Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Ufl1 G T 4: 25,270,572 Q215K probably benign Het
Unkl T C 17: 25,231,865 *232R probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Xkr4 T C 1: 3,216,570 T466A probably benign Het
Zfp451 T A 1: 33,769,817 K988* probably null Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Sgo2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sgo2b APN 8 63926523 missense probably benign
IGL01343:Sgo2b APN 8 63927315 nonsense probably null
IGL02027:Sgo2b APN 8 63926829 missense probably benign
IGL02090:Sgo2b APN 8 63927089 missense probably damaging 0.99
IGL02121:Sgo2b APN 8 63931282 missense possibly damaging 0.94
IGL02206:Sgo2b APN 8 63941084 missense possibly damaging 0.94
IGL02554:Sgo2b APN 8 63926537 missense probably damaging 0.96
IGL02663:Sgo2b APN 8 63943114 missense probably damaging 0.97
IGL03149:Sgo2b APN 8 63926583 missense probably benign 0.14
floater UTSW 8 63938417 nonsense probably null
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0164:Sgo2b UTSW 8 63938383 missense possibly damaging 0.92
R0201:Sgo2b UTSW 8 63926636 missense probably benign
R0285:Sgo2b UTSW 8 63928789 nonsense probably null
R0325:Sgo2b UTSW 8 63928376 missense probably benign 0.20
R0727:Sgo2b UTSW 8 63927782 missense probably damaging 0.98
R0943:Sgo2b UTSW 8 63931335 missense possibly damaging 0.82
R1148:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1266:Sgo2b UTSW 8 63928421 missense probably benign 0.00
R1484:Sgo2b UTSW 8 63931473 missense possibly damaging 0.77
R1493:Sgo2b UTSW 8 63926855 missense probably damaging 0.99
R1537:Sgo2b UTSW 8 63926502 missense possibly damaging 0.94
R1630:Sgo2b UTSW 8 63927797 missense possibly damaging 0.90
R1803:Sgo2b UTSW 8 63927392 missense probably benign 0.01
R1912:Sgo2b UTSW 8 63931469 missense probably damaging 0.98
R1993:Sgo2b UTSW 8 63926833 missense probably benign 0.36
R2042:Sgo2b UTSW 8 63928527 missense probably benign
R2130:Sgo2b UTSW 8 63927147 missense probably benign 0.09
R2146:Sgo2b UTSW 8 63928023 missense probably benign 0.00
R2881:Sgo2b UTSW 8 63927536 missense probably damaging 0.99
R3686:Sgo2b UTSW 8 63931327 missense probably benign 0.20
R3706:Sgo2b UTSW 8 63928145 missense probably damaging 0.98
R3889:Sgo2b UTSW 8 63927743 missense possibly damaging 0.82
R3894:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R3895:Sgo2b UTSW 8 63928733 missense possibly damaging 0.91
R4058:Sgo2b UTSW 8 63926947 missense probably damaging 0.98
R4259:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4260:Sgo2b UTSW 8 63928296 missense probably benign 0.06
R4704:Sgo2b UTSW 8 63927790 missense probably damaging 0.98
R4815:Sgo2b UTSW 8 63931414 missense probably benign
R4922:Sgo2b UTSW 8 63926630 missense possibly damaging 0.66
R5232:Sgo2b UTSW 8 63928602 missense possibly damaging 0.55
R5262:Sgo2b UTSW 8 63943137 missense probably damaging 0.99
R5444:Sgo2b UTSW 8 63926556 missense possibly damaging 0.90
R5677:Sgo2b UTSW 8 63926974 missense possibly damaging 0.77
R5959:Sgo2b UTSW 8 63927288 missense probably benign 0.01
R6004:Sgo2b UTSW 8 63926673 nonsense probably null
R6267:Sgo2b UTSW 8 63927793 missense probably benign
R6328:Sgo2b UTSW 8 63928311 nonsense probably null
R6517:Sgo2b UTSW 8 63931494 missense probably damaging 0.99
R6523:Sgo2b UTSW 8 63927504 missense probably benign 0.11
R6726:Sgo2b UTSW 8 63927735 nonsense probably null
R6957:Sgo2b UTSW 8 63931455 small deletion probably benign
R7031:Sgo2b UTSW 8 63940044 missense possibly damaging 0.94
R7034:Sgo2b UTSW 8 63926834 missense probably benign 0.36
R7145:Sgo2b UTSW 8 63928184 missense probably damaging 1.00
R7289:Sgo2b UTSW 8 63941158 missense probably damaging 0.97
R7366:Sgo2b UTSW 8 63938417 nonsense probably null
R7660:Sgo2b UTSW 8 63940074 missense probably benign 0.27
R7761:Sgo2b UTSW 8 63926912 missense probably benign
R7762:Sgo2b UTSW 8 63926497 missense probably benign 0.03
R7822:Sgo2b UTSW 8 63927284 missense probably damaging 0.98
R8111:Sgo2b UTSW 8 63943104 missense probably damaging 0.98
R8129:Sgo2b UTSW 8 63928800 missense possibly damaging 0.90
R8856:Sgo2b UTSW 8 63940057 missense probably null 0.99
R9249:Sgo2b UTSW 8 63938373 nonsense probably null
R9428:Sgo2b UTSW 8 63940033 missense probably damaging 0.99
RF014:Sgo2b UTSW 8 63931405 missense possibly damaging 0.94
RF055:Sgo2b UTSW 8 63943169 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63927005 missense probably damaging 1.00
Z1088:Sgo2b UTSW 8 63928422 missense possibly damaging 0.61
Z1177:Sgo2b UTSW 8 63927439 missense probably benign 0.03
Z1177:Sgo2b UTSW 8 63928385 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAGCAGGCATATCAGACTCAC -3'
(R):5'- GAGAAAGTCTGTCAATGCTCAAC -3'

Sequencing Primer
(F):5'- GAGCAGGCATATCAGACTCACTTAAG -3'
(R):5'- AGTCTGTCAATGCTCAACAAAATC -3'
Posted On 2018-04-02