Incidental Mutation 'R3690:Olfr294'
ID269726
Institutional Source Beutler Lab
Gene Symbol Olfr294
Ensembl Gene ENSMUSG00000062042
Gene Nameolfactory receptor 294
SynonymsGA_x6K02T2NHDJ-9504525-9505532, MOR219-5
MMRRC Submission 040685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3690 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86615636-86616643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86616478 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 56 (P56S)
Ref Sequence ENSEMBL: ENSMUSP00000077662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078588]
Predicted Effect probably damaging
Transcript: ENSMUST00000078588
AA Change: P56S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077662
Gene: ENSMUSG00000062042
AA Change: P56S

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 1.2e-38 PFAM
Pfam:7tm_1 39 288 1.8e-22 PFAM
Meta Mutation Damage Score 0.3930 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T A 6: 23,091,329 Y629F probably benign Het
Abcb5 T A 12: 118,872,933 D1081V probably damaging Het
Afdn A G 17: 13,888,409 E1398G probably damaging Het
Atp8b5 T C 4: 43,368,055 C893R probably damaging Het
Avl9 C T 6: 56,736,827 H357Y probably benign Het
Bclaf1 C T 10: 20,325,397 T423I possibly damaging Het
Btbd19 A T 4: 117,120,592 probably benign Het
Cap1 A G 4: 122,864,626 S254P probably damaging Het
Cdc42ep1 T C 15: 78,847,429 S25P probably benign Het
Cln6 T C 9: 62,846,970 I98T possibly damaging Het
Cul9 T C 17: 46,504,031 probably null Het
Dcx T C X: 143,877,244 E268G possibly damaging Het
Ddias G A 7: 92,860,158 P183L probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
Dusp16 C T 6: 134,761,119 probably benign Het
Egfr T C 11: 16,871,881 probably benign Het
Fam171a1 T C 2: 3,226,356 V842A probably benign Het
Folr1 T C 7: 101,858,538 S232G probably benign Het
Foxj3 T C 4: 119,616,642 probably benign Het
Fpr-rs6 T C 17: 20,182,875 M75V probably benign Het
Fxyd5 G T 7: 31,036,439 L128M possibly damaging Het
Gigyf2 T C 1: 87,421,516 S500P possibly damaging Het
Inppl1 A G 7: 101,832,068 L268P probably damaging Het
Klk1b24 A T 7: 44,191,819 H192L probably benign Het
Llgl1 T G 11: 60,707,002 Y316D probably damaging Het
Lmbrd1 T A 1: 24,762,293 *143R probably null Het
Map3k15 T A X: 160,122,572 N1295K possibly damaging Het
Mcm3ap A G 10: 76,482,679 E678G probably damaging Het
Mrpl44 T A 1: 79,779,649 Y270* probably null Het
Nav1 T A 1: 135,467,644 I996L probably benign Het
Neb T C 2: 52,137,385 E6868G probably damaging Het
Nexmif A T X: 104,087,607 Y235N probably damaging Het
Nup50 C T 15: 84,939,793 T449M probably damaging Het
Olfr11 A G 13: 21,639,338 F62L probably damaging Het
Olfr612 T C 7: 103,539,067 T56A probably benign Het
Olfr666 T C 7: 104,893,517 Y37C possibly damaging Het
Olfr675 A G 7: 105,024,695 L95P probably damaging Het
Pald1 A T 10: 61,355,808 probably null Het
Pde11a T A 2: 76,291,166 K357I probably damaging Het
Ric3 A G 7: 109,038,610 V312A possibly damaging Het
Scaper C T 9: 55,883,921 G231D probably benign Het
Smc1b T A 15: 85,117,263 probably benign Het
Smcr8 A G 11: 60,778,028 M1V probably null Het
Smtn T C 11: 3,527,687 probably benign Het
Spatc1 A T 15: 76,268,295 K42* probably null Het
Taf7l A T X: 134,464,325 I449K probably damaging Het
Tex47 A G 5: 7,304,777 probably benign Het
Tram2 T A 1: 21,005,600 Y198F probably damaging Het
Ttn C G 2: 76,799,244 W14284C probably damaging Het
Ube3a A G 7: 59,276,799 K442E probably damaging Het
Vmn2r116 T A 17: 23,384,824 F8I unknown Het
Vmn2r59 A G 7: 42,011,946 F815S possibly damaging Het
Zap70 T C 1: 36,781,412 C563R probably damaging Het
Zfp579 T C 7: 4,994,720 H64R probably damaging Het
Other mutations in Olfr294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Olfr294 APN 7 86615997 missense probably damaging 1.00
IGL02617:Olfr294 APN 7 86615664 missense probably benign 0.14
IGL02694:Olfr294 APN 7 86616310 missense probably benign 0.00
IGL02828:Olfr294 APN 7 86616069 missense possibly damaging 0.67
IGL03229:Olfr294 APN 7 86616078 missense probably benign 0.00
IGL03351:Olfr294 APN 7 86615677 missense possibly damaging 0.68
PIT4802001:Olfr294 UTSW 7 86616555 missense probably null 1.00
R0848:Olfr294 UTSW 7 86615640 missense probably damaging 0.96
R1448:Olfr294 UTSW 7 86616361 missense probably damaging 1.00
R1720:Olfr294 UTSW 7 86616456 missense probably damaging 1.00
R1734:Olfr294 UTSW 7 86616217 missense probably benign 0.07
R1959:Olfr294 UTSW 7 86616431 missense probably benign 0.00
R2116:Olfr294 UTSW 7 86616078 missense probably benign 0.00
R2518:Olfr294 UTSW 7 86616187 missense probably benign 0.03
R3034:Olfr294 UTSW 7 86615762 missense possibly damaging 0.50
R3110:Olfr294 UTSW 7 86615676 missense probably benign
R3112:Olfr294 UTSW 7 86615676 missense probably benign
R4612:Olfr294 UTSW 7 86615736 missense probably benign 0.00
R6476:Olfr294 UTSW 7 86616010 missense probably benign 0.04
R6895:Olfr294 UTSW 7 86616115 missense probably damaging 1.00
R7102:Olfr294 UTSW 7 86616267 missense probably benign 0.25
R7104:Olfr294 UTSW 7 86615692 missense probably null 0.07
R7179:Olfr294 UTSW 7 86616366 missense possibly damaging 0.76
R7256:Olfr294 UTSW 7 86615665 missense probably benign 0.03
R7624:Olfr294 UTSW 7 86616561 missense possibly damaging 0.47
R8422:Olfr294 UTSW 7 86616258 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCTCATAGTGTAGGGGACAGC -3'
(R):5'- TGTGGAAGACTCTAGCATGCTC -3'

Sequencing Primer
(F):5'- CATGGCTGTTAGGACAAATACGTCTC -3'
(R):5'- TCAATGCCACTAGAATAACAGGGTTC -3'
Posted On2015-02-19