Mutagenetix > Incidental Mutation

Incidental Mutation 'R3690:Olfr294'

269726

Institutional Source

Beutler Lab

Gene Symbol

Olfr294

Ensembl Gene

ENSMUSG00000062042

Gene Name

olfactory receptor 294

Synonyms

GA_x6K02T2NHDJ-9504525-9505532, MOR219-5

MMRRC Submission

040685-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.164) question?

Stock #

R3690 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86615636-86616643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 86616478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 56 (P56S)

Ref Sequence

ENSEMBL: ENSMUSP00000077662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078588]

AlphaFold

F7CWV4

Predicted Effect

probably damaging
Transcript: ENSMUST00000078588
AA Change: P56S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077662
Gene: ENSMUSG00000062042
AA Change: P56S

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	309	1.2e-38	PFAM
Pfam:7tm_1	39	288	1.8e-22	PFAM

Meta Mutation Damage Score

0.3930

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aass	T	A	6: 23,091,329	Y629F	probably benign	Het
Abcb5	T	A	12: 118,872,933	D1081V	probably damaging	Het
Afdn	A	G	17: 13,888,409	E1398G	probably damaging	Het
Atp8b5	T	C	4: 43,368,055	C893R	probably damaging	Het
Avl9	C	T	6: 56,736,827	H357Y	probably benign	Het
Bclaf1	C	T	10: 20,325,397	T423I	possibly damaging	Het
Btbd19	A	T	4: 117,120,592		probably benign	Het
Cap1	A	G	4: 122,864,626	S254P	probably damaging	Het
Cdc42ep1	T	C	15: 78,847,429	S25P	probably benign	Het
Cln6	T	C	9: 62,846,970	I98T	possibly damaging	Het
Cul9	T	C	17: 46,504,031		probably null	Het
Dcx	T	C	X: 143,877,244	E268G	possibly damaging	Het
Ddias	G	A	7: 92,860,158	P183L	probably benign	Het
Dnase2b	A	T	3: 146,593,571	Y42*	probably null	Het
Dusp16	C	T	6: 134,761,119		probably benign	Het
Egfr	T	C	11: 16,871,881		probably benign	Het
Fam171a1	T	C	2: 3,226,356	V842A	probably benign	Het
Folr1	T	C	7: 101,858,538	S232G	probably benign	Het
Foxj3	T	C	4: 119,616,642		probably benign	Het
Fpr-rs6	T	C	17: 20,182,875	M75V	probably benign	Het
Fxyd5	G	T	7: 31,036,439	L128M	possibly damaging	Het
Gigyf2	T	C	1: 87,421,516	S500P	possibly damaging	Het
Inppl1	A	G	7: 101,832,068	L268P	probably damaging	Het
Klk1b24	A	T	7: 44,191,819	H192L	probably benign	Het
Llgl1	T	G	11: 60,707,002	Y316D	probably damaging	Het
Lmbrd1	T	A	1: 24,762,293	*143R	probably null	Het
Map3k15	T	A	X: 160,122,572	N1295K	possibly damaging	Het
Mcm3ap	A	G	10: 76,482,679	E678G	probably damaging	Het
Mrpl44	T	A	1: 79,779,649	Y270*	probably null	Het
Nav1	T	A	1: 135,467,644	I996L	probably benign	Het
Neb	T	C	2: 52,137,385	E6868G	probably damaging	Het
Nexmif	A	T	X: 104,087,607	Y235N	probably damaging	Het
Nup50	C	T	15: 84,939,793	T449M	probably damaging	Het
Olfr11	A	G	13: 21,639,338	F62L	probably damaging	Het
Olfr612	T	C	7: 103,539,067	T56A	probably benign	Het
Olfr666	T	C	7: 104,893,517	Y37C	possibly damaging	Het
Olfr675	A	G	7: 105,024,695	L95P	probably damaging	Het
Pald1	A	T	10: 61,355,808		probably null	Het
Pde11a	T	A	2: 76,291,166	K357I	probably damaging	Het
Ric3	A	G	7: 109,038,610	V312A	possibly damaging	Het
Scaper	C	T	9: 55,883,921	G231D	probably benign	Het
Smc1b	T	A	15: 85,117,263		probably benign	Het
Smcr8	A	G	11: 60,778,028	M1V	probably null	Het
Smtn	T	C	11: 3,527,687		probably benign	Het
Spatc1	A	T	15: 76,268,295	K42*	probably null	Het
Taf7l	A	T	X: 134,464,325	I449K	probably damaging	Het
Tex47	A	G	5: 7,304,777		probably benign	Het
Tram2	T	A	1: 21,005,600	Y198F	probably damaging	Het
Ttn	C	G	2: 76,799,244	W14284C	probably damaging	Het
Ube3a	A	G	7: 59,276,799	K442E	probably damaging	Het
Vmn2r116	T	A	17: 23,384,824	F8I	unknown	Het
Vmn2r59	A	G	7: 42,011,946	F815S	possibly damaging	Het
Zap70	T	C	1: 36,781,412	C563R	probably damaging	Het
Zfp579	T	C	7: 4,994,720	H64R	probably damaging	Het

Other mutations in Olfr294

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Olfr294	APN	7	86615997	missense	probably damaging	1.00
IGL02617:Olfr294	APN	7	86615664	missense	probably benign	0.14
IGL02694:Olfr294	APN	7	86616310	missense	probably benign	0.00
IGL02828:Olfr294	APN	7	86616069	missense	possibly damaging	0.67
IGL03229:Olfr294	APN	7	86616078	missense	probably benign	0.00
IGL03351:Olfr294	APN	7	86615677	missense	possibly damaging	0.68
PIT4802001:Olfr294	UTSW	7	86616555	missense	probably null	1.00
R0848:Olfr294	UTSW	7	86615640	missense	probably damaging	0.96
R1448:Olfr294	UTSW	7	86616361	missense	probably damaging	1.00
R1720:Olfr294	UTSW	7	86616456	missense	probably damaging	1.00
R1734:Olfr294	UTSW	7	86616217	missense	probably benign	0.07
R1959:Olfr294	UTSW	7	86616431	missense	probably benign	0.00
R2116:Olfr294	UTSW	7	86616078	missense	probably benign	0.00
R2518:Olfr294	UTSW	7	86616187	missense	probably benign	0.03
R3034:Olfr294	UTSW	7	86615762	missense	possibly damaging	0.50
R3110:Olfr294	UTSW	7	86615676	missense	probably benign
R3112:Olfr294	UTSW	7	86615676	missense	probably benign
R4612:Olfr294	UTSW	7	86615736	missense	probably benign	0.00
R6476:Olfr294	UTSW	7	86616010	missense	probably benign	0.04
R6895:Olfr294	UTSW	7	86616115	missense	probably damaging	1.00
R7102:Olfr294	UTSW	7	86616267	missense	probably benign	0.25
R7104:Olfr294	UTSW	7	86615692	missense	probably null	0.07
R7179:Olfr294	UTSW	7	86616366	missense	possibly damaging	0.76
R7256:Olfr294	UTSW	7	86615665	missense	probably benign	0.03
R7624:Olfr294	UTSW	7	86616561	missense	possibly damaging	0.47
R8422:Olfr294	UTSW	7	86616258	missense	probably benign	0.13
R9432:Olfr294	UTSW	7	86615857	missense	possibly damaging	0.66
R9700:Olfr294	UTSW	7	86616410	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTCATAGTGTAGGGGACAGC -3'
(R):5'- TGTGGAAGACTCTAGCATGCTC -3'

Sequencing Primer
(F):5'- CATGGCTGTTAGGACAAATACGTCTC -3'
(R):5'- TCAATGCCACTAGAATAACAGGGTTC -3'

Posted On

2015-02-19