Incidental Mutation 'R3731:Phtf1'
ID270972
Institutional Source Beutler Lab
Gene Symbol Phtf1
Ensembl Gene ENSMUSG00000058388
Gene Nameputative homeodomain transcription factor 1
SynonymsPhft
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103968110-104024598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103985779 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 120 (M120V)
Ref Sequence ENSEMBL: ENSMUSP00000118281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055425] [ENSMUST00000063717] [ENSMUST00000090685] [ENSMUST00000117150] [ENSMUST00000123611] [ENSMUST00000145727] [ENSMUST00000150849] [ENSMUST00000156262]
Predicted Effect probably benign
Transcript: ENSMUST00000055425
AA Change: M67V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058137
Gene: ENSMUSG00000058388
AA Change: M67V

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 60 8.6e-31 PFAM
Pfam:Phtf-FEM1B_bdg 57 105 5.2e-18 PFAM
low complexity region 117 128 N/A INTRINSIC
low complexity region 294 317 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
transmembrane domain 557 579 N/A INTRINSIC
transmembrane domain 594 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063717
AA Change: M120V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066607
Gene: ENSMUSG00000058388
AA Change: M120V

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 5 151 9.9e-73 PFAM
low complexity region 155 163 N/A INTRINSIC
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090685
AA Change: M120V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088184
Gene: ENSMUSG00000058388
AA Change: M120V

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 8.9e-89 PFAM
low complexity region 302 325 N/A INTRINSIC
transmembrane domain 428 447 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
transmembrane domain 565 587 N/A INTRINSIC
transmembrane domain 602 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117150
AA Change: M120V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113973
Gene: ENSMUSG00000058388
AA Change: M120V

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123611
AA Change: M101V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116193
Gene: ENSMUSG00000058388
AA Change: M101V

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 9 139 1.7e-67 PFAM
low complexity region 151 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145727
AA Change: M120V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114722
Gene: ENSMUSG00000058388
AA Change: M120V

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 1.6e-88 PFAM
low complexity region 170 181 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 512 534 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
transmembrane domain 647 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150090
Predicted Effect probably benign
Transcript: ENSMUST00000150849
AA Change: M120V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000118281
Gene: ENSMUSG00000058388
AA Change: M120V

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 158 4.5e-90 PFAM
low complexity region 170 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156262
AA Change: M67V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121036
Gene: ENSMUSG00000058388
AA Change: M67V

DomainStartEndE-ValueType
Pfam:Phtf-FEM1B_bdg 3 60 1e-31 PFAM
Pfam:Phtf-FEM1B_bdg 57 105 7.2e-19 PFAM
low complexity region 117 128 N/A INTRINSIC
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Phtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phtf1 APN 3 103988667 missense probably benign
IGL01139:Phtf1 APN 3 104005602 missense probably damaging 1.00
IGL01677:Phtf1 APN 3 103998783 missense probably damaging 1.00
IGL02169:Phtf1 APN 3 103997499 missense probably benign
IGL02542:Phtf1 APN 3 103993906 splice site probably benign
IGL02557:Phtf1 APN 3 103998765 missense probably damaging 1.00
IGL02697:Phtf1 APN 3 103997563 missense probably benign
IGL02807:Phtf1 APN 3 103997553 missense probably benign 0.00
R0140:Phtf1 UTSW 3 103987560 missense probably null 1.00
R0555:Phtf1 UTSW 3 104004469 missense probably damaging 1.00
R0620:Phtf1 UTSW 3 103993765 missense probably damaging 1.00
R1480:Phtf1 UTSW 3 103987434 nonsense probably null
R1799:Phtf1 UTSW 3 103996642 missense probably benign 0.01
R1804:Phtf1 UTSW 3 103987567 unclassified probably benign
R1921:Phtf1 UTSW 3 103969122 nonsense probably null
R1943:Phtf1 UTSW 3 103993882 nonsense probably null
R2006:Phtf1 UTSW 3 104004483 critical splice donor site probably null
R3729:Phtf1 UTSW 3 103985779 missense probably benign 0.00
R4051:Phtf1 UTSW 3 104005508 missense possibly damaging 0.92
R4210:Phtf1 UTSW 3 104003603 critical splice donor site probably null
R4211:Phtf1 UTSW 3 104003603 critical splice donor site probably null
R4730:Phtf1 UTSW 3 103987435 missense probably damaging 1.00
R4982:Phtf1 UTSW 3 103998708 missense probably damaging 1.00
R5314:Phtf1 UTSW 3 103999287 missense probably damaging 1.00
R5321:Phtf1 UTSW 3 104003511 missense probably benign 0.31
R5499:Phtf1 UTSW 3 103991175 missense probably benign 0.00
R6134:Phtf1 UTSW 3 104004405 missense probably damaging 0.99
R6603:Phtf1 UTSW 3 103993873 missense probably damaging 1.00
R7242:Phtf1 UTSW 3 103998696 missense probably damaging 0.99
R7311:Phtf1 UTSW 3 103997664 missense possibly damaging 0.64
R7519:Phtf1 UTSW 3 103969119 missense probably damaging 1.00
R7601:Phtf1 UTSW 3 103993845 missense probably benign 0.03
R7657:Phtf1 UTSW 3 103969113 missense probably benign 0.00
R8354:Phtf1 UTSW 3 104004449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGGATATTCCTGCTTCCAG -3'
(R):5'- TCAGCATCAAACAACTGTCATTTCG -3'

Sequencing Primer
(F):5'- CCAGTTTGCAGATATTTCCAGGAG -3'
(R):5'- CAACTGTCATTTCGTCAAATATGC -3'
Posted On2015-03-18