Incidental Mutation 'R3758:Olfr777'
ID271528
Institutional Source Beutler Lab
Gene Symbol Olfr777
Ensembl Gene ENSMUSG00000062914
Gene Nameolfactory receptor 777
SynonymsGA_x6K02T2PULF-10955551-10954616, MOR114-9
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129264407-129271485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129269065 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 86 (D86G)
Ref Sequence ENSEMBL: ENSMUSP00000145475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080313] [ENSMUST00000204573] [ENSMUST00000213512]
Predicted Effect probably damaging
Transcript: ENSMUST00000080313
AA Change: D86G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079191
Gene: ENSMUSG00000062914
AA Change: D86G

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.4e-42 PFAM
Pfam:7tm_1 38 287 1.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204573
AA Change: D86G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145475
Gene: ENSMUSG00000062914
AA Change: D86G

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.4e-42 PFAM
Pfam:7tm_1 38 287 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213512
Meta Mutation Damage Score 0.1812 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Olfr777
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Olfr777 APN 10 129268523 missense probably benign 0.18
IGL01782:Olfr777 APN 10 129269039 missense probably benign 0.00
R0554:Olfr777 UTSW 10 129268499 missense probably benign 0.00
R0594:Olfr777 UTSW 10 129269152 missense possibly damaging 0.95
R1792:Olfr777 UTSW 10 129269243 missense probably benign 0.20
R2357:Olfr777 UTSW 10 129268773 missense probably benign 0.31
R2426:Olfr777 UTSW 10 129269266 missense probably benign 0.00
R3757:Olfr777 UTSW 10 129269065 missense probably damaging 0.99
R3962:Olfr777 UTSW 10 129268666 missense probably damaging 1.00
R4600:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R4603:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R4611:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R5113:Olfr777 UTSW 10 129268666 missense probably damaging 0.98
R6415:Olfr777 UTSW 10 129269021 missense probably benign 0.01
R7540:Olfr777 UTSW 10 129269134 missense probably benign 0.31
R7909:Olfr777 UTSW 10 129269267 missense probably benign 0.00
R8170:Olfr777 UTSW 10 129269048 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCCAGCAACTGAGGATAAGTC -3'
(R):5'- ACTGACGGATGATCCACAACTG -3'

Sequencing Primer
(F):5'- CTGAGGATAAGTCTTGCACAGATCC -3'
(R):5'- GGATGATCCACAACTGAAAACTCTG -3'
Posted On2015-03-18