Incidental Mutation 'R3758:Nmd3'
ID271512
Institutional Source Beutler Lab
Gene Symbol Nmd3
Ensembl Gene ENSMUSG00000027787
Gene NameNMD3 ribosome export adaptor
SynonymsC87860
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location69721985-69756373 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 69724308 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 32 (C32*)
Ref Sequence ENSEMBL: ENSMUSP00000115736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029358] [ENSMUST00000135266] [ENSMUST00000143041] [ENSMUST00000143249]
Predicted Effect probably null
Transcript: ENSMUST00000029358
AA Change: C32*
SMART Domains Protein: ENSMUSP00000029358
Gene: ENSMUSG00000027787
AA Change: C32*

DomainStartEndE-ValueType
Pfam:NMD3 17 246 6.6e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127211
Predicted Effect probably null
Transcript: ENSMUST00000135266
AA Change: C32*
SMART Domains Protein: ENSMUSP00000142290
Gene: ENSMUSG00000027787
AA Change: C32*

DomainStartEndE-ValueType
Pfam:NMD3 17 128 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143041
Predicted Effect probably null
Transcript: ENSMUST00000143249
AA Change: C32*
SMART Domains Protein: ENSMUSP00000115736
Gene: ENSMUSG00000027787
AA Change: C32*

DomainStartEndE-ValueType
Pfam:NMD3 17 76 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194168
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomal 40S and 60S subunits associate in the nucleolus and are exported to the cytoplasm. The protein encoded by this gene is involved in the passage of the 60S subunit through the nuclear pore complex and into the cytoplasm. Several transcript variants exist for this gene, but the full-length natures of only two have been described to date. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Nmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Nmd3 APN 3 69745240 missense possibly damaging 0.63
IGL01014:Nmd3 APN 3 69726386 missense probably benign 0.00
IGL01289:Nmd3 APN 3 69724287 missense possibly damaging 0.85
IGL02566:Nmd3 APN 3 69739914 unclassified probably benign
IGL03259:Nmd3 APN 3 69745243 missense possibly damaging 0.49
IGL03299:Nmd3 APN 3 69730429 splice site probably null
IGL03382:Nmd3 APN 3 69735088 missense probably damaging 0.99
R0017:Nmd3 UTSW 3 69736092 splice site probably null
R0025:Nmd3 UTSW 3 69748321 missense probably damaging 1.00
R0350:Nmd3 UTSW 3 69743574 missense probably damaging 1.00
R1136:Nmd3 UTSW 3 69746716 splice site probably benign
R1635:Nmd3 UTSW 3 69739984 missense probably benign 0.03
R3081:Nmd3 UTSW 3 69724399 splice site probably benign
R3686:Nmd3 UTSW 3 69746762 missense probably damaging 1.00
R4384:Nmd3 UTSW 3 69724398 splice site probably benign
R4774:Nmd3 UTSW 3 69745236 missense probably benign 0.11
R4778:Nmd3 UTSW 3 69731591 nonsense probably null
R4953:Nmd3 UTSW 3 69731637 missense possibly damaging 0.92
R5000:Nmd3 UTSW 3 69717402 unclassified probably benign
R5182:Nmd3 UTSW 3 69722468 critical splice donor site probably null
R6043:Nmd3 UTSW 3 69745247 missense probably benign
R6355:Nmd3 UTSW 3 69729347 missense probably benign 0.22
R6760:Nmd3 UTSW 3 69746837 critical splice donor site probably null
R7869:Nmd3 UTSW 3 69726417 missense probably damaging 1.00
R8024:Nmd3 UTSW 3 69729965 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCGATGTTTCAGGATTCTTC -3'
(R):5'- CTCAACAGCACGTTTCATTCCG -3'

Sequencing Primer
(F):5'- GTGTGCTGAAAATTGACCCC -3'
(R):5'- CCGTATACTTCAGAGTAATCTCAGC -3'
Posted On2015-03-18