Incidental Mutation 'R3758:Bcat1'
ID271521
Institutional Source Beutler Lab
Gene Symbol Bcat1
Ensembl Gene ENSMUSG00000030268
Gene Namebranched chain aminotransferase 1, cytosolic
SynonymsEca39, Bcat-1, BCATc
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R3758 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location144993835-145076184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145032872 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 208 (I208F)
Ref Sequence ENSEMBL: ENSMUSP00000032402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000123930] [ENSMUST00000149769] [ENSMUST00000204138]
Predicted Effect probably damaging
Transcript: ENSMUST00000032402
AA Change: I208F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: I208F

DomainStartEndE-ValueType
Pfam:Aminotran_4 160 410 1.3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048252
AA Change: I141F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268
AA Change: I141F

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 5.9e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111742
AA Change: I141F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268
AA Change: I141F

DomainStartEndE-ValueType
Pfam:Aminotran_4 111 354 1.7e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123930
AA Change: I140F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120180
Gene: ENSMUSG00000030268
AA Change: I140F

DomainStartEndE-ValueType
PDB:2COJ|B 2 224 1e-139 PDB
SCOP:d1ekfa_ 21 224 1e-76 SMART
Blast:FN3 129 192 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136819
SMART Domains Protein: ENSMUSP00000117708
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2COJ|B 2 76 2e-45 PDB
SCOP:d1ekfa_ 2 76 2e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145911
Predicted Effect probably damaging
Transcript: ENSMUST00000149769
AA Change: I116F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116091
Gene: ENSMUSG00000030268
AA Change: I116F

DomainStartEndE-ValueType
PDB:2ABJ|J 2 136 1e-78 PDB
SCOP:d1ekfa_ 2 136 1e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154611
SMART Domains Protein: ENSMUSP00000123137
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2COJ|B 1 84 2e-46 PDB
SCOP:d1ekfa_ 1 84 4e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155693
SMART Domains Protein: ENSMUSP00000116565
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
PDB:2COJ|B 1 112 8e-64 PDB
SCOP:d1ekfa_ 1 112 2e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204138
SMART Domains Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268

DomainStartEndE-ValueType
Pfam:Aminotran_4 34 180 9.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Bcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcat1 APN 6 145000289 missense possibly damaging 0.89
IGL01882:Bcat1 APN 6 145004409 missense probably damaging 1.00
IGL02021:Bcat1 APN 6 145047289 splice site probably benign
IGL02024:Bcat1 APN 6 145032838 missense probably damaging 0.97
IGL02705:Bcat1 APN 6 145019188 splice site probably benign
IGL02954:Bcat1 APN 6 145019219 missense probably damaging 1.00
R0331:Bcat1 UTSW 6 145047314 missense probably benign 0.17
R1592:Bcat1 UTSW 6 145010058 missense probably benign 0.00
R1680:Bcat1 UTSW 6 145039628 missense probably damaging 1.00
R2162:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R2306:Bcat1 UTSW 6 145007653 missense probably damaging 0.96
R3498:Bcat1 UTSW 6 145019342 missense probably damaging 0.99
R3831:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R3833:Bcat1 UTSW 6 145010108 missense probably damaging 1.00
R4829:Bcat1 UTSW 6 145015475 missense probably damaging 1.00
R5250:Bcat1 UTSW 6 145047439 critical splice donor site probably null
R5338:Bcat1 UTSW 6 145007627 missense possibly damaging 0.50
R5414:Bcat1 UTSW 6 145015447 critical splice donor site probably null
R5679:Bcat1 UTSW 6 145007748 missense probably damaging 1.00
R6566:Bcat1 UTSW 6 145015484 missense probably damaging 1.00
R7015:Bcat1 UTSW 6 145039583 missense probably damaging 0.99
R7255:Bcat1 UTSW 6 145032785 nonsense probably null
R7606:Bcat1 UTSW 6 145048632 missense probably benign 0.06
R8115:Bcat1 UTSW 6 145010093 missense probably damaging 1.00
RF004:Bcat1 UTSW 6 145007623 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGACATCCACACACGTG -3'
(R):5'- CGATGTTTCATGTTAGGAAAGAGTG -3'

Sequencing Primer
(F):5'- CACACGTGGTGGCTCAC -3'
(R):5'- TGAATAAAAGCTGTTGAAGGAGCC -3'
Posted On2015-03-18