Incidental Mutation 'R3856:Vmn1r189'
List |< first << previous [record 52 of 53] next >> last >|
ID276178
Institutional Source Beutler Lab
Gene Symbol Vmn1r189
Ensembl Gene ENSMUSG00000099611
Gene Namevomeronasal 1 receptor 189
SynonymsV1rh2
MMRRC Submission 040902-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R3856 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22099762-22105824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22102269 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 133 (F133I)
Ref Sequence ENSEMBL: ENSMUSP00000154722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186062] [ENSMUST00000227357] [ENSMUST00000228428]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075055
AA Change: F133I

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074566
Gene: ENSMUSG00000061222
AA Change: F133I

DomainStartEndE-ValueType
Pfam:V1R 33 297 7.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186062
AA Change: F133I

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140924
Gene: ENSMUSG00000099611
AA Change: F133I

DomainStartEndE-ValueType
Pfam:7tm_1 30 283 1e-7 PFAM
Pfam:V1R 33 297 7.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227357
AA Change: F133I

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228428
AA Change: F133I

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.7%
  • 20x: 92.4%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,055,446 S469P possibly damaging Het
Adgrf5 A T 17: 43,447,036 N787I possibly damaging Het
Ank2 T C 3: 126,929,844 T945A probably benign Het
Aox4 T A 1: 58,253,934 I863N probably damaging Het
Ap3d1 A G 10: 80,712,185 I891T probably benign Het
Apex1 A G 14: 50,926,257 T109A probably benign Het
Arhgef1 G A 7: 24,919,272 G107S probably damaging Het
Atxn7l1 A G 12: 33,367,600 T587A probably damaging Het
Atxn7l3 T C 11: 102,293,903 D128G probably damaging Het
Cacna1h T C 17: 25,392,453 Y457C probably damaging Het
Ccdc60 A C 5: 116,172,455 C183G probably damaging Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Cnst C T 1: 179,579,714 P109S probably benign Het
Crtc2 G T 3: 90,262,570 L509F probably damaging Het
Ctsr A T 13: 61,161,936 I153N possibly damaging Het
Dffa A T 4: 149,104,251 M1L possibly damaging Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Eef2k T A 7: 120,899,371 C91* probably null Het
Eml5 T C 12: 98,816,024 D1336G probably damaging Het
F12 G A 13: 55,421,222 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbxo40 A T 16: 36,969,083 L555Q probably damaging Het
Frmpd1 T C 4: 45,283,698 S840P probably damaging Het
Gadd45a C T 6: 67,037,005 probably null Het
Galnt7 T C 8: 57,532,624 probably benign Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr171 T C 3: 59,098,085 T90A probably damaging Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
H2-M10.6 T A 17: 36,812,504 I30N probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Hspa4l C A 3: 40,785,389 H698Q probably benign Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Kdm4a C T 4: 118,153,231 R605H probably damaging Het
Nhlrc2 T C 19: 56,588,271 probably null Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr608 T A 7: 103,470,660 V207E probably damaging Het
Pbp2 A G 6: 135,310,145 L68P probably benign Het
Pcnx3 G T 19: 5,678,967 T547K probably benign Het
Ppp1r12a T C 10: 108,253,501 probably benign Het
Prmt9 G A 8: 77,568,265 V413I probably benign Het
Pudp T C 18: 50,568,053 N203S probably benign Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sall3 G A 18: 80,972,502 T737M probably damaging Het
Scn2b A G 9: 45,125,461 N89S possibly damaging Het
Sgsm1 A G 5: 113,263,259 V580A probably benign Het
Slc13a4 C A 6: 35,271,604 probably null Het
Slc4a4 A C 5: 89,232,839 S1015R probably benign Het
Slc8a1 T C 17: 81,648,374 T412A probably benign Het
Spag17 A T 3: 100,106,759 D2116V probably damaging Het
Trim55 T C 3: 19,672,956 F396L probably benign Het
Usp54 C A 14: 20,588,420 M197I probably damaging Het
Zfp735 T C 11: 73,711,456 S409P probably benign Het
Other mutations in Vmn1r189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03084:Vmn1r189 APN 13 22101838 nonsense probably null
R0437:Vmn1r189 UTSW 13 22102061 missense probably damaging 0.99
R1199:Vmn1r189 UTSW 13 22102658 missense probably damaging 0.99
R1795:Vmn1r189 UTSW 13 22102154 missense probably benign 0.03
R2251:Vmn1r189 UTSW 13 22102548 missense probably damaging 1.00
R3751:Vmn1r189 UTSW 13 22102212 missense probably benign 0.00
R3824:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3825:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R4688:Vmn1r189 UTSW 13 22102119 missense probably damaging 0.99
R5665:Vmn1r189 UTSW 13 22102166 missense probably damaging 1.00
R5778:Vmn1r189 UTSW 13 22102382 missense probably damaging 0.99
R6149:Vmn1r189 UTSW 13 22101884 missense probably benign 0.33
R6431:Vmn1r189 UTSW 13 22102355 missense probably damaging 0.98
R6660:Vmn1r189 UTSW 13 22101896 missense possibly damaging 0.89
R6974:Vmn1r189 UTSW 13 22102458 missense probably damaging 1.00
R7051:Vmn1r189 UTSW 13 22102115 missense possibly damaging 0.58
R7269:Vmn1r189 UTSW 13 22102567 missense probably benign 0.00
R7330:Vmn1r189 UTSW 13 22102541 missense possibly damaging 0.95
R7611:Vmn1r189 UTSW 13 22102152 missense probably benign 0.02
R7894:Vmn1r189 UTSW 13 22101736 nonsense probably null
R7977:Vmn1r189 UTSW 13 22101736 nonsense probably null
Z1177:Vmn1r189 UTSW 13 22101883 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGGCACCCTGAAACACTG -3'
(R):5'- GACTGCCAAAGACAGTAGCAGC -3'

Sequencing Primer
(F):5'- TGCATCTCTCAGGACCATGAGAG -3'
(R):5'- CTGCCAAAGACAGTAGCAGCTTTTG -3'
Posted On2015-04-06