Incidental Mutation 'R0360:Il24'
ID30030
Institutional Source Beutler Lab
Gene Symbol Il24
Ensembl Gene ENSMUSG00000026420
Gene Nameinterleukin 24
SynonymsMda-7, FISP
MMRRC Submission 038566-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0360 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location130882074-130887454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130883937 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 134 (V134A)
Ref Sequence ENSEMBL: ENSMUSP00000113064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038829] [ENSMUST00000121040] [ENSMUST00000187650] [ENSMUST00000188148] [ENSMUST00000191279]
Predicted Effect probably benign
Transcript: ENSMUST00000038829
SMART Domains Protein: ENSMUSP00000048303
Gene: ENSMUSG00000042474

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:V-set 21 122 1.3e-10 PFAM
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 264 283 N/A INTRINSIC
low complexity region 285 311 N/A INTRINSIC
low complexity region 344 363 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121040
AA Change: V134A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113064
Gene: ENSMUSG00000026420
AA Change: V134A

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
IL10 76 219 1.14e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145446
Predicted Effect probably damaging
Transcript: ENSMUST00000187650
AA Change: V95A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140149
Gene: ENSMUSG00000026420
AA Change: V95A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL10 37 180 5.4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188148
SMART Domains Protein: ENSMUSP00000139907
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000191279
SMART Domains Protein: ENSMUSP00000140821
Gene: ENSMUSG00000026420

DomainStartEndE-ValueType
low complexity region 44 56 N/A INTRINSIC
Blast:IL10 76 118 2e-21 BLAST
SCOP:d2ilk__ 80 119 2e-9 SMART
Meta Mutation Damage Score 0.7620 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IL10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. The protein encoded by this gene can induce apoptosis selectively in various cancer cells. Overexpression of this gene leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal induction of epidermal hyperplasia in response to intradermal IL-23 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Adcyap1r1 G T 6: 55,475,523 probably benign Het
Ankrd6 T C 4: 32,836,424 T44A probably damaging Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Bhlhe40 C A 6: 108,664,750 N218K probably damaging Het
Bms1 A G 6: 118,405,290 V429A probably benign Het
C7 T A 15: 4,988,962 T800S probably benign Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc157 T C 11: 4,146,663 E362G probably damaging Het
Ccdc73 T A 2: 104,981,007 N310K probably damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Cnst C A 1: 179,579,535 A49E probably benign Het
Col5a3 C T 9: 20,772,466 R1498Q unknown Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
D16Ertd472e A T 16: 78,547,885 C112S probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Dpp6 T C 5: 27,652,269 L404P probably damaging Het
Dsc3 T A 18: 19,971,582 T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 E214D possibly damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fancm A G 12: 65,075,950 Y82C probably damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gchfr T G 2: 119,167,846 Y3* probably null Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gm6614 A C 6: 141,982,327 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hgd T A 16: 37,611,184 probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Icam4 A G 9: 21,029,821 Y123C probably damaging Het
Iqcb1 G T 16: 36,872,308 A562S probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Kif1b A G 4: 149,262,729 I330T probably damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Klf10 C T 15: 38,296,846 V317M probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Lin37 T C 7: 30,557,013 I97V possibly damaging Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Lrrc74a A G 12: 86,737,795 H99R probably damaging Het
Maats1 T A 16: 38,298,297 probably null Het
Me3 T A 7: 89,786,414 probably null Het
Med13 T C 11: 86,329,161 probably benign Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Myo10 T C 15: 25,804,368 L1583P probably damaging Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Nlrp5-ps A C 7: 14,583,091 noncoding transcript Het
Nup188 T G 2: 30,326,479 I765S probably null Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr348 T A 2: 36,787,440 M305K probably benign Het
Olfr76 G T 19: 12,119,853 D286E possibly damaging Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Otogl T A 10: 107,770,650 probably benign Het
Pcnx3 G A 19: 5,665,583 R1472W probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plscr4 T A 9: 92,488,761 probably benign Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Rgl3 A G 9: 21,976,857 W454R probably damaging Het
Rita1 A G 5: 120,609,772 S154P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Sec23ip G A 7: 128,761,405 probably benign Het
Slc23a1 T A 18: 35,622,979 probably benign Het
Sparcl1 T A 5: 104,089,637 D444V probably damaging Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tmcc3 T A 10: 94,578,545 N36K probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vmn1r58 G T 7: 5,410,330 H300Q probably benign Het
Vmn1r84 A G 7: 12,361,872 L286P probably damaging Het
Vmn2r54 A T 7: 12,615,649 C669S probably damaging Het
Wdr61 A T 9: 54,727,578 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Il24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Il24 APN 1 130883877 missense probably damaging 1.00
IGL02540:Il24 APN 1 130887303 unclassified probably benign
IGL02959:Il24 APN 1 130885733 nonsense probably null
IGL03191:Il24 APN 1 130884847 missense probably benign 0.06
R1738:Il24 UTSW 1 130887362 splice site probably null
R1755:Il24 UTSW 1 130883943 missense possibly damaging 0.58
R1984:Il24 UTSW 1 130882531 missense probably benign 0.01
R1985:Il24 UTSW 1 130882531 missense probably benign 0.01
R1986:Il24 UTSW 1 130882531 missense probably benign 0.01
R2090:Il24 UTSW 1 130884837 missense possibly damaging 0.90
R4970:Il24 UTSW 1 130883442 splice site probably null
R5112:Il24 UTSW 1 130883442 splice site probably null
R5590:Il24 UTSW 1 130882516 missense possibly damaging 0.72
R6128:Il24 UTSW 1 130885698 missense probably damaging 0.97
R7061:Il24 UTSW 1 130883371 missense possibly damaging 0.81
X0021:Il24 UTSW 1 130885585 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTTTGCCCATGACATCCAGGAC -3'
(R):5'- TGTGATTCATACGCTGCTCCTCAAG -3'

Sequencing Primer
(F):5'- CTCTTTGTCGGGAAAAGAAGCC -3'
(R):5'- AAGACTCCTGTCATCTCTTCAG -3'
Posted On2013-04-24