Mutagenetix > Incidental Mutation

Incidental Mutation 'R0360:Il24'

30030

Institutional Source

Beutler Lab

Gene Symbol

Il24

Ensembl Gene

ENSMUSG00000026420

Gene Name

interleukin 24

Synonyms

Mda-7, FISP

MMRRC Submission

038566-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130882074-130887454 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130883937 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 134 (V134A)

Ref Sequence

ENSEMBL: ENSMUSP00000113064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038829] [ENSMUST00000121040] [ENSMUST00000187650] [ENSMUST00000188148] [ENSMUST00000191279]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000038829

SMART Domains

Protein: ENSMUSP00000048303
Gene: ENSMUSG00000042474

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:V-set	21	122	1.3e-10	PFAM
low complexity region	212	223	N/A	INTRINSIC
transmembrane domain	264	283	N/A	INTRINSIC
low complexity region	285	311	N/A	INTRINSIC
low complexity region	344	363	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121040
AA Change: V134A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113064
Gene: ENSMUSG00000026420
AA Change: V134A

Domain	Start	End	E-Value	Type
low complexity region	44	56	N/A	INTRINSIC
IL10	76	219	1.14e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126821

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145446

Predicted Effect

probably damaging
Transcript: ENSMUST00000187650
AA Change: V95A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140149
Gene: ENSMUSG00000026420
AA Change: V95A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
IL10	37	180	5.4e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000188148

SMART Domains

Protein: ENSMUSP00000139907
Gene: ENSMUSG00000026420

Domain	Start	End	E-Value	Type
low complexity region	37	50	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000191279

SMART Domains

Protein: ENSMUSP00000140821
Gene: ENSMUSG00000026420

Domain	Start	End	E-Value	Type
low complexity region	44	56	N/A	INTRINSIC
Blast:IL10	76	118	2e-21	BLAST
SCOP:d2ilk__	80	119	2e-9	SMART

Meta Mutation Damage Score

0.7620

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IL10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. The protein encoded by this gene can induce apoptosis selectively in various cancer cells. Overexpression of this gene leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal induction of epidermal hyperplasia in response to intradermal IL-23 treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	G	A	7: 28,611,128		probably benign	Het
Adcyap1r1	G	T	6: 55,475,523		probably benign	Het
Ankrd6	T	C	4: 32,836,424	T44A	probably damaging	Het
Ano7	A	G	1: 93,388,658	D221G	probably benign	Het
Bhlhe40	C	A	6: 108,664,750	N218K	probably damaging	Het
Bms1	A	G	6: 118,405,290	V429A	probably benign	Het
C7	T	A	15: 4,988,962	T800S	probably benign	Het
Camta2	G	A	11: 70,683,310	T127I	probably damaging	Het
Ccdc13	T	A	9: 121,798,216	N665I	probably damaging	Het
Ccdc157	T	C	11: 4,146,663	E362G	probably damaging	Het
Ccdc73	T	A	2: 104,981,007	N310K	probably damaging	Het
Cmklr1	A	T	5: 113,614,517	L141H	probably damaging	Het
Cnst	C	A	1: 179,579,535	A49E	probably benign	Het
Col5a3	C	T	9: 20,772,466	R1498Q	unknown	Het
Crybb3	T	A	5: 113,075,953	I197F	probably damaging	Het
Cryzl1	G	A	16: 91,707,267	P97S	probably benign	Het
Cubn	T	C	2: 13,310,507		probably benign	Het
Cyp2d37-ps	T	C	15: 82,690,052		noncoding transcript	Het
Cyp4a12b	C	A	4: 115,432,920	N223K	probably benign	Het
D16Ertd472e	A	T	16: 78,547,885	C112S	probably benign	Het
Dennd2a	T	C	6: 39,508,299	T349A	probably benign	Het
Dock5	G	A	14: 67,822,680		probably benign	Het
Dpp6	T	C	5: 27,652,269	L404P	probably damaging	Het
Dsc3	T	A	18: 19,971,582	T563S	possibly damaging	Het
Dync2h1	T	A	9: 7,113,182	E214D	possibly damaging	Het
Elac2	A	G	11: 64,979,310	Y67C	probably damaging	Het
Elmo1	A	T	13: 20,564,493	K503*	probably null	Het
Eng	T	C	2: 32,679,137	S559P	probably benign	Het
Epc2	T	A	2: 49,537,133	V563E	possibly damaging	Het
Fancm	A	G	12: 65,075,950	Y82C	probably damaging	Het
Flt4	A	T	11: 49,636,991	M924L	probably benign	Het
Gabpa	T	A	16: 84,857,387	N317K	possibly damaging	Het
Gchfr	T	G	2: 119,167,846	Y3*	probably null	Het
Gli3	G	T	13: 15,724,764	G912V	probably benign	Het
Gm10295	C	A	7: 71,350,613	C73F	unknown	Het
Gm10382	G	T	5: 125,389,664		probably benign	Het
Gm6614	A	C	6: 141,982,327		probably benign	Het
Gp1ba	T	C	11: 70,640,458		probably benign	Het
Gpr146	G	A	5: 139,379,178		probably benign	Het
Hexdc	T	A	11: 121,212,143	H62Q	probably benign	Het
Hgd	T	A	16: 37,611,184		probably benign	Het
Hs6st1	G	A	1: 36,069,185		probably null	Het
Icam4	A	G	9: 21,029,821	Y123C	probably damaging	Het
Iqcb1	G	T	16: 36,872,308	A562S	probably damaging	Het
Iqgap2	A	C	13: 95,731,275		probably benign	Het
Islr2	T	C	9: 58,199,744	T78A	possibly damaging	Het
Kif1b	A	G	4: 149,262,729	I330T	probably damaging	Het
Kirrel	T	C	3: 87,089,799	Y287C	probably damaging	Het
Klf10	C	T	15: 38,296,846	V317M	probably benign	Het
Klhl9	T	G	4: 88,720,290	K571N	probably benign	Het
Lin37	T	C	7: 30,557,013	I97V	possibly damaging	Het
Lrrc37a	C	T	11: 103,500,640	V1320I	possibly damaging	Het
Lrrc74a	A	G	12: 86,737,795	H99R	probably damaging	Het
Maats1	T	A	16: 38,298,297		probably null	Het
Me3	T	A	7: 89,786,414		probably null	Het
Med13	T	C	11: 86,329,161		probably benign	Het
Myh6	A	T	14: 54,948,347	Y1490*	probably null	Het
Myo10	T	C	15: 25,804,368	L1583P	probably damaging	Het
Nkx6-3	A	G	8: 23,157,706	E227G	possibly damaging	Het
Nlrp1a	T	A	11: 71,114,004		probably benign	Het
Nlrp5-ps	A	C	7: 14,583,091		noncoding transcript	Het
Nup188	T	G	2: 30,326,479	I765S	probably null	Het
Obscn	G	A	11: 59,128,281	A969V	probably benign	Het
Olfr1080	A	T	2: 86,553,779	L115Q	probably damaging	Het
Olfr348	T	A	2: 36,787,440	M305K	probably benign	Het
Olfr76	G	T	19: 12,119,853	D286E	possibly damaging	Het
Olfr96	T	C	17: 37,226,043	L306P	possibly damaging	Het
Otogl	T	A	10: 107,770,650		probably benign	Het
Pcnx3	G	A	19: 5,665,583	R1472W	probably damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plscr4	T	A	9: 92,488,761		probably benign	Het
Pon2	G	A	6: 5,266,156	Q288*	probably null	Het
Ptpn13	C	A	5: 103,533,348	R805S	probably damaging	Het
Pyroxd2	A	T	19: 42,747,553	V62D	probably damaging	Het
Rab37	G	T	11: 115,156,964	C44F	probably damaging	Het
Rbm44	T	C	1: 91,152,347	S52P	probably benign	Het
Rgl3	A	G	9: 21,976,857	W454R	probably damaging	Het
Rita1	A	G	5: 120,609,772	S154P	probably benign	Het
Scn5a	T	C	9: 119,522,599	D772G	probably damaging	Het
Sec23ip	G	A	7: 128,761,405		probably benign	Het
Slc23a1	T	A	18: 35,622,979		probably benign	Het
Sparcl1	T	A	5: 104,089,637	D444V	probably damaging	Het
Taar6	C	A	10: 23,985,148	V167L	probably benign	Het
Tmcc3	T	A	10: 94,578,545	N36K	probably benign	Het
Tmem200c	T	A	17: 68,840,548	V42E	probably damaging	Het
Trhde	T	C	10: 114,502,982		probably benign	Het
Tshz3	A	G	7: 36,770,533	E649G	probably benign	Het
Utp4	T	C	8: 106,898,537		probably benign	Het
Vmn1r30	A	G	6: 58,435,277	V190A	probably benign	Het
Vmn1r35	A	G	6: 66,678,843	I281T	probably damaging	Het
Vmn1r58	G	T	7: 5,410,330	H300Q	probably benign	Het
Vmn1r84	A	G	7: 12,361,872	L286P	probably damaging	Het
Vmn2r54	A	T	7: 12,615,649	C669S	probably damaging	Het
Wdr61	A	T	9: 54,727,578		probably benign	Het
Zfp623	T	C	15: 75,948,661	S489P	probably benign	Het

Other mutations in Il24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01934:Il24	APN	1	130883877	missense	probably damaging	1.00
IGL02540:Il24	APN	1	130887303	unclassified	probably benign
IGL02959:Il24	APN	1	130885733	nonsense	probably null
IGL03191:Il24	APN	1	130884847	missense	probably benign	0.06
R1738:Il24	UTSW	1	130887362	splice site	probably null
R1755:Il24	UTSW	1	130883943	missense	possibly damaging	0.58
R1984:Il24	UTSW	1	130882531	missense	probably benign	0.01
R1985:Il24	UTSW	1	130882531	missense	probably benign	0.01
R1986:Il24	UTSW	1	130882531	missense	probably benign	0.01
R2090:Il24	UTSW	1	130884837	missense	possibly damaging	0.90
R4970:Il24	UTSW	1	130883442	splice site	probably null
R5112:Il24	UTSW	1	130883442	splice site	probably null
R5590:Il24	UTSW	1	130882516	missense	possibly damaging	0.72
R6128:Il24	UTSW	1	130885698	missense	probably damaging	0.97
R7061:Il24	UTSW	1	130883371	missense	possibly damaging	0.81
R9114:Il24	UTSW	1	130885746	missense	possibly damaging	0.86
R9465:Il24	UTSW	1	130885725	missense	probably benign	0.18
X0021:Il24	UTSW	1	130885585	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACCTTTGCCCATGACATCCAGGAC -3'
(R):5'- TGTGATTCATACGCTGCTCCTCAAG -3'

Sequencing Primer
(F):5'- CTCTTTGTCGGGAAAAGAAGCC -3'
(R):5'- AAGACTCCTGTCATCTCTTCAG -3'

Posted On

2013-04-24