Incidental Mutation 'R0360:Fancm'
ID30061
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission 038566-MU
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R0360 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65075950 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 82 (Y82C)
Ref Sequence ENSEMBL: ENSMUSP00000152854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021332] [ENSMUST00000058889] [ENSMUST00000220730] [ENSMUST00000221166] [ENSMUST00000221913] [ENSMUST00000222540]
Predicted Effect probably benign
Transcript: ENSMUST00000021332
SMART Domains Protein: ENSMUSP00000021332
Gene: ENSMUSG00000020949

DomainStartEndE-ValueType
PDB:2KFV|A 1 73 2e-45 PDB
low complexity region 91 100 N/A INTRINSIC
Pfam:FKBP_C 121 221 3.9e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058889
AA Change: Y82C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: Y82C

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220957
Predicted Effect probably benign
Transcript: ENSMUST00000220983
Predicted Effect probably benign
Transcript: ENSMUST00000221166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221710
Predicted Effect probably benign
Transcript: ENSMUST00000221913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222467
Predicted Effect probably damaging
Transcript: ENSMUST00000222540
AA Change: Y82C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223519
Meta Mutation Damage Score 0.9323 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Adcyap1r1 G T 6: 55,475,523 probably benign Het
Ankrd6 T C 4: 32,836,424 T44A probably damaging Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Bhlhe40 C A 6: 108,664,750 N218K probably damaging Het
Bms1 A G 6: 118,405,290 V429A probably benign Het
C7 T A 15: 4,988,962 T800S probably benign Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc157 T C 11: 4,146,663 E362G probably damaging Het
Ccdc73 T A 2: 104,981,007 N310K probably damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Cnst C A 1: 179,579,535 A49E probably benign Het
Col5a3 C T 9: 20,772,466 R1498Q unknown Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
D16Ertd472e A T 16: 78,547,885 C112S probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Dpp6 T C 5: 27,652,269 L404P probably damaging Het
Dsc3 T A 18: 19,971,582 T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 E214D possibly damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gchfr T G 2: 119,167,846 Y3* probably null Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gm6614 A C 6: 141,982,327 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hgd T A 16: 37,611,184 probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Icam4 A G 9: 21,029,821 Y123C probably damaging Het
Il24 A G 1: 130,883,937 V134A probably damaging Het
Iqcb1 G T 16: 36,872,308 A562S probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Kif1b A G 4: 149,262,729 I330T probably damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Klf10 C T 15: 38,296,846 V317M probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Lin37 T C 7: 30,557,013 I97V possibly damaging Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Lrrc74a A G 12: 86,737,795 H99R probably damaging Het
Maats1 T A 16: 38,298,297 probably null Het
Me3 T A 7: 89,786,414 probably null Het
Med13 T C 11: 86,329,161 probably benign Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Myo10 T C 15: 25,804,368 L1583P probably damaging Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Nlrp5-ps A C 7: 14,583,091 noncoding transcript Het
Nup188 T G 2: 30,326,479 I765S probably null Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr348 T A 2: 36,787,440 M305K probably benign Het
Olfr76 G T 19: 12,119,853 D286E possibly damaging Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Otogl T A 10: 107,770,650 probably benign Het
Pcnx3 G A 19: 5,665,583 R1472W probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plscr4 T A 9: 92,488,761 probably benign Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Rgl3 A G 9: 21,976,857 W454R probably damaging Het
Rita1 A G 5: 120,609,772 S154P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Sec23ip G A 7: 128,761,405 probably benign Het
Slc23a1 T A 18: 35,622,979 probably benign Het
Sparcl1 T A 5: 104,089,637 D444V probably damaging Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tmcc3 T A 10: 94,578,545 N36K probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vmn1r58 G T 7: 5,410,330 H300Q probably benign Het
Vmn1r84 A G 7: 12,361,872 L286P probably damaging Het
Vmn2r54 A T 7: 12,615,649 C669S probably damaging Het
Wdr61 A T 9: 54,727,578 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
BB005:Fancm UTSW 12 65106124 missense unknown
BB015:Fancm UTSW 12 65106124 missense unknown
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2117:Fancm UTSW 12 65077174 missense probably damaging 1.00
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
R7498:Fancm UTSW 12 65099391 missense probably benign 0.01
R7585:Fancm UTSW 12 65106247 missense possibly damaging 0.62
R7610:Fancm UTSW 12 65105680 missense probably damaging 1.00
R7722:Fancm UTSW 12 65106461 missense probably damaging 1.00
R7740:Fancm UTSW 12 65126547 missense possibly damaging 0.90
R7867:Fancm UTSW 12 65116466 critical splice donor site probably null
R7867:Fancm UTSW 12 65118399 missense probably benign 0.12
R7882:Fancm UTSW 12 65126794 missense probably benign 0.12
R7928:Fancm UTSW 12 65106124 missense unknown
R8230:Fancm UTSW 12 65102650 missense probably benign 0.17
Z1176:Fancm UTSW 12 65094926 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCATCTTCCCGCCGCAAAATCG -3'
(R):5'- GCAGGCTTCCATCTGCTGTGTTAC -3'

Sequencing Primer
(F):5'- AGAACGCTCTTCCAGACGTG -3'
(R):5'- CCATCTGCTGTGTTACCAGGG -3'
Posted On2013-04-24