Mutagenetix > Incidental Mutations

Incidental Mutation 'R0360:Kif1b'

30035

Institutional Source

Beutler Lab

Gene Symbol

Kif1b

Ensembl Gene

ENSMUSG00000063077

Gene Name

kinesin family member 1B

Synonyms

Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204

MMRRC Submission

038566-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

149176319-149307693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 149262729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 330 (I330T)

Ref Sequence

ENSEMBL: ENSMUSP00000030806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030806] [ENSMUST00000055647] [ENSMUST00000060537]

AlphaFold

Q60575

Predicted Effect

probably damaging
Transcript: ENSMUST00000030806
AA Change: I330T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030806
Gene: ENSMUSG00000063077
AA Change: I330T

Domain	Start	End	E-Value	Type
KISc	3	356	5.85e-176	SMART
low complexity region	389	404	N/A	INTRINSIC
FHA	509	566	1.61e-4	SMART
coiled coil region	626	660	N/A	INTRINSIC
coiled coil region	814	858	N/A	INTRINSIC
low complexity region	889	902	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000055647
AA Change: I330T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: I330T

Domain	Start	End	E-Value	Type
KISc	3	356	5.85e-176	SMART
low complexity region	389	404	N/A	INTRINSIC
FHA	509	566	1.61e-4	SMART
coiled coil region	626	685	N/A	INTRINSIC
Pfam:KIF1B	799	846	9.7e-13	PFAM
internal_repeat_1	901	933	7.01e-7	PROSPERO
low complexity region	1165	1179	N/A	INTRINSIC
Pfam:DUF3694	1220	1368	1.1e-46	PFAM
low complexity region	1444	1461	N/A	INTRINSIC
low complexity region	1479	1507	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC
PH	1656	1755	1.02e-14	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060537
AA Change: I336T

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: I336T

Domain	Start	End	E-Value	Type
KISc	3	362	7.61e-175	SMART
low complexity region	390	400	N/A	INTRINSIC
low complexity region	432	450	N/A	INTRINSIC
FHA	555	612	1.61e-4	SMART
coiled coil region	672	731	N/A	INTRINSIC
Pfam:KIF1B	845	892	7.1e-15	PFAM
internal_repeat_1	947	979	4.76e-7	PROSPERO
low complexity region	1211	1225	N/A	INTRINSIC
Pfam:DUF3694	1266	1413	1.1e-40	PFAM
low complexity region	1490	1507	N/A	INTRINSIC
low complexity region	1525	1553	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
PH	1702	1801	1.02e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150230

Meta Mutation Damage Score

0.3181

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	G	A	7: 28,611,128		probably benign	Het
Adcyap1r1	G	T	6: 55,475,523		probably benign	Het
Ankrd6	T	C	4: 32,836,424	T44A	probably damaging	Het
Ano7	A	G	1: 93,388,658	D221G	probably benign	Het
Bhlhe40	C	A	6: 108,664,750	N218K	probably damaging	Het
Bms1	A	G	6: 118,405,290	V429A	probably benign	Het
C7	T	A	15: 4,988,962	T800S	probably benign	Het
Camta2	G	A	11: 70,683,310	T127I	probably damaging	Het
Ccdc13	T	A	9: 121,798,216	N665I	probably damaging	Het
Ccdc157	T	C	11: 4,146,663	E362G	probably damaging	Het
Ccdc73	T	A	2: 104,981,007	N310K	probably damaging	Het
Cmklr1	A	T	5: 113,614,517	L141H	probably damaging	Het
Cnst	C	A	1: 179,579,535	A49E	probably benign	Het
Col5a3	C	T	9: 20,772,466	R1498Q	unknown	Het
Crybb3	T	A	5: 113,075,953	I197F	probably damaging	Het
Cryzl1	G	A	16: 91,707,267	P97S	probably benign	Het
Cubn	T	C	2: 13,310,507		probably benign	Het
Cyp2d37-ps	T	C	15: 82,690,052		noncoding transcript	Het
Cyp4a12b	C	A	4: 115,432,920	N223K	probably benign	Het
D16Ertd472e	A	T	16: 78,547,885	C112S	probably benign	Het
Dennd2a	T	C	6: 39,508,299	T349A	probably benign	Het
Dock5	G	A	14: 67,822,680		probably benign	Het
Dpp6	T	C	5: 27,652,269	L404P	probably damaging	Het
Dsc3	T	A	18: 19,971,582	T563S	possibly damaging	Het
Dync2h1	T	A	9: 7,113,182	E214D	possibly damaging	Het
Elac2	A	G	11: 64,979,310	Y67C	probably damaging	Het
Elmo1	A	T	13: 20,564,493	K503*	probably null	Het
Eng	T	C	2: 32,679,137	S559P	probably benign	Het
Epc2	T	A	2: 49,537,133	V563E	possibly damaging	Het
Fancm	A	G	12: 65,075,950	Y82C	probably damaging	Het
Flt4	A	T	11: 49,636,991	M924L	probably benign	Het
Gabpa	T	A	16: 84,857,387	N317K	possibly damaging	Het
Gchfr	T	G	2: 119,167,846	Y3*	probably null	Het
Gli3	G	T	13: 15,724,764	G912V	probably benign	Het
Gm10295	C	A	7: 71,350,613	C73F	unknown	Het
Gm10382	G	T	5: 125,389,664		probably benign	Het
Gm6614	A	C	6: 141,982,327		probably benign	Het
Gp1ba	T	C	11: 70,640,458		probably benign	Het
Gpr146	G	A	5: 139,379,178		probably benign	Het
Hexdc	T	A	11: 121,212,143	H62Q	probably benign	Het
Hgd	T	A	16: 37,611,184		probably benign	Het
Hs6st1	G	A	1: 36,069,185		probably null	Het
Icam4	A	G	9: 21,029,821	Y123C	probably damaging	Het
Il24	A	G	1: 130,883,937	V134A	probably damaging	Het
Iqcb1	G	T	16: 36,872,308	A562S	probably damaging	Het
Iqgap2	A	C	13: 95,731,275		probably benign	Het
Islr2	T	C	9: 58,199,744	T78A	possibly damaging	Het
Kirrel	T	C	3: 87,089,799	Y287C	probably damaging	Het
Klf10	C	T	15: 38,296,846	V317M	probably benign	Het
Klhl9	T	G	4: 88,720,290	K571N	probably benign	Het
Lin37	T	C	7: 30,557,013	I97V	possibly damaging	Het
Lrrc37a	C	T	11: 103,500,640	V1320I	possibly damaging	Het
Lrrc74a	A	G	12: 86,737,795	H99R	probably damaging	Het
Maats1	T	A	16: 38,298,297		probably null	Het
Me3	T	A	7: 89,786,414		probably null	Het
Med13	T	C	11: 86,329,161		probably benign	Het
Myh6	A	T	14: 54,948,347	Y1490*	probably null	Het
Myo10	T	C	15: 25,804,368	L1583P	probably damaging	Het
Nkx6-3	A	G	8: 23,157,706	E227G	possibly damaging	Het
Nlrp1a	T	A	11: 71,114,004		probably benign	Het
Nlrp5-ps	A	C	7: 14,583,091		noncoding transcript	Het
Nup188	T	G	2: 30,326,479	I765S	probably null	Het
Obscn	G	A	11: 59,128,281	A969V	probably benign	Het
Olfr1080	A	T	2: 86,553,779	L115Q	probably damaging	Het
Olfr348	T	A	2: 36,787,440	M305K	probably benign	Het
Olfr76	G	T	19: 12,119,853	D286E	possibly damaging	Het
Olfr96	T	C	17: 37,226,043	L306P	possibly damaging	Het
Otogl	T	A	10: 107,770,650		probably benign	Het
Pcnx3	G	A	19: 5,665,583	R1472W	probably damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plscr4	T	A	9: 92,488,761		probably benign	Het
Pon2	G	A	6: 5,266,156	Q288*	probably null	Het
Ptpn13	C	A	5: 103,533,348	R805S	probably damaging	Het
Pyroxd2	A	T	19: 42,747,553	V62D	probably damaging	Het
Rab37	G	T	11: 115,156,964	C44F	probably damaging	Het
Rbm44	T	C	1: 91,152,347	S52P	probably benign	Het
Rgl3	A	G	9: 21,976,857	W454R	probably damaging	Het
Rita1	A	G	5: 120,609,772	S154P	probably benign	Het
Scn5a	T	C	9: 119,522,599	D772G	probably damaging	Het
Sec23ip	G	A	7: 128,761,405		probably benign	Het
Slc23a1	T	A	18: 35,622,979		probably benign	Het
Sparcl1	T	A	5: 104,089,637	D444V	probably damaging	Het
Taar6	C	A	10: 23,985,148	V167L	probably benign	Het
Tmcc3	T	A	10: 94,578,545	N36K	probably benign	Het
Tmem200c	T	A	17: 68,840,548	V42E	probably damaging	Het
Trhde	T	C	10: 114,502,982		probably benign	Het
Tshz3	A	G	7: 36,770,533	E649G	probably benign	Het
Utp4	T	C	8: 106,898,537		probably benign	Het
Vmn1r30	A	G	6: 58,435,277	V190A	probably benign	Het
Vmn1r35	A	G	6: 66,678,843	I281T	probably damaging	Het
Vmn1r58	G	T	7: 5,410,330	H300Q	probably benign	Het
Vmn1r84	A	G	7: 12,361,872	L286P	probably damaging	Het
Vmn2r54	A	T	7: 12,615,649	C669S	probably damaging	Het
Wdr61	A	T	9: 54,727,578		probably benign	Het
Zfp623	T	C	15: 75,948,661	S489P	probably benign	Het

Other mutations in Kif1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Kif1b	APN	4	149220602	missense	probably damaging	1.00
IGL01943:Kif1b	APN	4	149214905	critical splice donor site	probably null
IGL02240:Kif1b	APN	4	149246414	missense	probably damaging	1.00
IGL02414:Kif1b	APN	4	149199314	missense	probably damaging	0.96
IGL02490:Kif1b	APN	4	149204208	missense	probably benign
IGL02501:Kif1b	APN	4	149214976	missense	probably damaging	1.00
IGL02833:Kif1b	APN	4	149246364	missense	probably damaging	1.00
IGL02852:Kif1b	APN	4	149291328	missense	probably damaging	1.00
IGL02900:Kif1b	APN	4	149180809	missense	possibly damaging	0.81
IGL03287:Kif1b	APN	4	149214981	missense	possibly damaging	0.67
IGL03412:Kif1b	APN	4	149274939	missense	probably benign	0.00
PIT4305001:Kif1b	UTSW	4	149220792	critical splice acceptor site	probably null
R0005:Kif1b	UTSW	4	149181927	missense	probably damaging	1.00
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0129:Kif1b	UTSW	4	149261201	missense	probably benign
R0180:Kif1b	UTSW	4	149213659	missense	probably damaging	1.00
R0288:Kif1b	UTSW	4	149199338	missense	probably damaging	1.00
R0383:Kif1b	UTSW	4	149202512	missense	probably damaging	1.00
R0398:Kif1b	UTSW	4	149204231	missense	possibly damaging	0.89
R0403:Kif1b	UTSW	4	149181967	nonsense	probably null
R0445:Kif1b	UTSW	4	149188009	missense	probably benign	0.01
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1681:Kif1b	UTSW	4	149195501	critical splice acceptor site	probably null
R1728:Kif1b	UTSW	4	149187722	missense	probably damaging	0.99
R1840:Kif1b	UTSW	4	149188132	missense	probably damaging	1.00
R1874:Kif1b	UTSW	4	149187632	missense	probably benign
R1915:Kif1b	UTSW	4	149267216	missense	probably damaging	1.00
R2106:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2124:Kif1b	UTSW	4	149222296	missense	probably benign	0.08
R2126:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2127:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2128:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2129:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2146:Kif1b	UTSW	4	149184309	missense	probably damaging	0.99
R2255:Kif1b	UTSW	4	149274997	missense	probably damaging	1.00
R2392:Kif1b	UTSW	4	149220620	missense	possibly damaging	0.93
R2883:Kif1b	UTSW	4	149237648	missense	possibly damaging	0.78
R2981:Kif1b	UTSW	4	149220541	critical splice donor site	probably null
R3038:Kif1b	UTSW	4	149213333	missense	probably benign	0.02
R3616:Kif1b	UTSW	4	149262283	splice site	probably benign
R3935:Kif1b	UTSW	4	149237160	missense	probably benign	0.00
R4347:Kif1b	UTSW	4	149247234	missense	probably damaging	1.00
R4423:Kif1b	UTSW	4	149214105	missense	probably damaging	0.99
R4637:Kif1b	UTSW	4	149199311	missense	probably damaging	0.97
R4745:Kif1b	UTSW	4	149237882	nonsense	probably null
R4807:Kif1b	UTSW	4	149247921	intron	probably benign
R5618:Kif1b	UTSW	4	149269889	missense	possibly damaging	0.94
R5644:Kif1b	UTSW	4	149238482	missense	probably damaging	0.96
R5683:Kif1b	UTSW	4	149222261	missense	probably damaging	1.00
R5696:Kif1b	UTSW	4	149273849	splice site	probably null
R6022:Kif1b	UTSW	4	149198532	missense	probably benign	0.01
R6048:Kif1b	UTSW	4	149263629	missense	probably damaging	1.00
R6137:Kif1b	UTSW	4	149238426	missense	possibly damaging	0.47
R6139:Kif1b	UTSW	4	149237532	missense	possibly damaging	0.88
R6171:Kif1b	UTSW	4	149258048	missense	probably damaging	1.00
R6250:Kif1b	UTSW	4	149213643	missense	probably benign	0.00
R6423:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6424:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6425:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6443:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6460:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6462:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6463:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6469:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6470:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6471:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6472:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6504:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6536:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6537:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6668:Kif1b	UTSW	4	149213407	missense	probably benign	0.09
R6698:Kif1b	UTSW	4	149274956	missense	probably damaging	0.99
R7065:Kif1b	UTSW	4	149202525	missense	possibly damaging	0.46
R7222:Kif1b	UTSW	4	149225157	missense	probably damaging	1.00
R7342:Kif1b	UTSW	4	149214090	missense	possibly damaging	0.94
R7720:Kif1b	UTSW	4	149182355	missense	probably benign	0.01
R7744:Kif1b	UTSW	4	149237075	missense	possibly damaging	0.83
R7797:Kif1b	UTSW	4	149237387	missense	probably benign
R7829:Kif1b	UTSW	4	149220990	splice site	probably null
R7869:Kif1b	UTSW	4	149184376	missense	probably benign	0.01
R7878:Kif1b	UTSW	4	149214997	missense	probably damaging	0.98
R7980:Kif1b	UTSW	4	149269921	missense	probably damaging	1.00
R8047:Kif1b	UTSW	4	149214922	missense	probably damaging	1.00
R8237:Kif1b	UTSW	4	149191185	missense	probably benign	0.10
R8243:Kif1b	UTSW	4	149204267	missense	probably benign
R8252:Kif1b	UTSW	4	149273805	missense	probably damaging	1.00
R8342:Kif1b	UTSW	4	149222348	missense	probably damaging	0.96
R8460:Kif1b	UTSW	4	149187620	missense	possibly damaging	0.93
R8462:Kif1b	UTSW	4	149182340	missense	probably benign	0.05
R8496:Kif1b	UTSW	4	149192611	nonsense	probably null
R8687:Kif1b	UTSW	4	149261163	nonsense	probably null
R8694:Kif1b	UTSW	4	149220567	missense	probably damaging	0.98
R8842:Kif1b	UTSW	4	149253739	missense	probably damaging	0.98
R8883:Kif1b	UTSW	4	149276885	missense	probably benign
R8971:Kif1b	UTSW	4	149247816	missense	probably damaging	1.00
R8994:Kif1b	UTSW	4	149195482	missense
R9002:Kif1b	UTSW	4	149191255	missense	probably damaging	0.96
R9227:Kif1b	UTSW	4	149237900	missense	probably damaging	1.00
R9231:Kif1b	UTSW	4	149191195	missense	possibly damaging	0.94
RF008:Kif1b	UTSW	4	149251738	splice site	probably null
X0009:Kif1b	UTSW	4	149247264	missense	probably damaging	1.00
X0062:Kif1b	UTSW	4	149275005	missense	probably damaging	1.00
Z1176:Kif1b	UTSW	4	149266298	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AACTCCCGAACCAGCTTGGCATTC -3'
(R):5'- CAAACCAGCATGGCTACGTGAGAC -3'

Sequencing Primer
(F):5'- cagaggtgacaaagactaagaac -3'
(R):5'- GCTACGTGAGACCTTGTCAG -3'

Posted On

2013-04-24