Incidental Mutation 'R3918:Nsun2'
ID307517
Institutional Source Beutler Lab
Gene Symbol Nsun2
Ensembl Gene ENSMUSG00000021595
Gene NameNOL1/NOP2/Sun domain family member 2
SynonymsMisu
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location69533746-69635780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69630680 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 516 (T516A)
Ref Sequence ENSEMBL: ENSMUSP00000135455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022087] [ENSMUST00000109699] [ENSMUST00000176485]
Predicted Effect probably benign
Transcript: ENSMUST00000022087
AA Change: T485A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022087
Gene: ENSMUSG00000021595
AA Change: T485A

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 83 209 4.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 199 376 1.1e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109699
AA Change: T551A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105321
Gene: ENSMUSG00000021595
AA Change: T551A

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 169 428 3.2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136932
Predicted Effect probably damaging
Transcript: ENSMUST00000176485
AA Change: T516A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135455
Gene: ENSMUSG00000021595
AA Change: T516A

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 114 240 3.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 230 399 1.1e-23 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that catalyzes the methylation of cytosine to 5-methylcytosine (m5C) at position 34 of intron-containing tRNA(Leu)(CAA) precursors. This modification is necessary to stabilize the anticodon-codon pairing and correctly translate the mRNA. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased body size, male sterility, and hair cycle anomalies. Additional phenotypes may include reduced body fat, skeletal, craniofacial and eye defects, abnormal erythropoiesis, and altered energy expenditure and gas, glucose, and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Nsun2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Nsun2 APN 13 69623249 missense probably benign 0.01
IGL01997:Nsun2 APN 13 69623246 missense probably damaging 1.00
IGL02253:Nsun2 APN 13 69619539 missense possibly damaging 0.88
IGL03038:Nsun2 APN 13 69619584 missense probably damaging 1.00
IGL02984:Nsun2 UTSW 13 69543608 intron probably benign
PIT4494001:Nsun2 UTSW 13 69618192 critical splice donor site probably null
R0601:Nsun2 UTSW 13 69633242 missense probably benign 0.40
R0648:Nsun2 UTSW 13 69627587 missense probably damaging 1.00
R0690:Nsun2 UTSW 13 69629542 missense probably benign
R0718:Nsun2 UTSW 13 69543697 intron probably benign
R1501:Nsun2 UTSW 13 69631587 missense probably damaging 1.00
R1638:Nsun2 UTSW 13 69627586 missense probably damaging 1.00
R1678:Nsun2 UTSW 13 69627103 missense probably damaging 1.00
R1687:Nsun2 UTSW 13 69627597 missense probably damaging 1.00
R2327:Nsun2 UTSW 13 69619581 missense probably benign 0.44
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R3689:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3691:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3739:Nsun2 UTSW 13 69629638 missense probably benign
R4065:Nsun2 UTSW 13 69612460 critical splice donor site probably null
R4231:Nsun2 UTSW 13 69619541 missense probably damaging 1.00
R4445:Nsun2 UTSW 13 69629721 splice site probably null
R4872:Nsun2 UTSW 13 69543873 intron probably benign
R5641:Nsun2 UTSW 13 69623249 missense probably benign 0.01
R5718:Nsun2 UTSW 13 69623284 missense probably benign 0.19
R5976:Nsun2 UTSW 13 69623152 splice site probably null
R6110:Nsun2 UTSW 13 69627648 missense probably benign 0.01
R6943:Nsun2 UTSW 13 69630033 missense probably damaging 1.00
R6968:Nsun2 UTSW 13 69631290 missense probably benign 0.00
R7146:Nsun2 UTSW 13 69626553 critical splice donor site probably null
R7456:Nsun2 UTSW 13 69633606 missense probably damaging 0.98
X0064:Nsun2 UTSW 13 69615519 critical splice donor site probably null
Z1088:Nsun2 UTSW 13 69615465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCAGCTCTTGTAACAGC -3'
(R):5'- GTTAGTAAGCACAGCCACTCG -3'

Sequencing Primer
(F):5'- TGTAACAGCCCTTTTCCTGG -3'
(R):5'- TCGGCTGGCAAACCTAAG -3'
Posted On2015-04-17