Incidental Mutation 'R3918:Txndc9'
ID307483
Institutional Source Beutler Lab
Gene Symbol Txndc9
Ensembl Gene ENSMUSG00000058407
Gene Namethioredoxin domain containing 9
SynonymsATP binding protein associated with cell differentiation, Apacd
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location37985189-37997893 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 37994050 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 84 (Q84*)
Ref Sequence ENSEMBL: ENSMUSP00000141609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027252] [ENSMUST00000162031] [ENSMUST00000192237] [ENSMUST00000192960] [ENSMUST00000193832] [ENSMUST00000195032] [ENSMUST00000195247]
Predicted Effect probably benign
Transcript: ENSMUST00000027252
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000072243
AA Change: Q84*
SMART Domains Protein: ENSMUSP00000072096
Gene: ENSMUSG00000058407
AA Change: Q84*

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 173 3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162031
AA Change: Q84*
SMART Domains Protein: ENSMUSP00000125491
Gene: ENSMUSG00000058407
AA Change: Q84*

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192237
AA Change: Q84*
SMART Domains Protein: ENSMUSP00000141640
Gene: ENSMUSG00000058407
AA Change: Q84*

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Pfam:Thioredoxin 75 166 6.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192548
Predicted Effect probably null
Transcript: ENSMUST00000192960
AA Change: Q84*
SMART Domains Protein: ENSMUSP00000141281
Gene: ENSMUSG00000058407
AA Change: Q84*

DomainStartEndE-ValueType
low complexity region 43 63 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000193832
AA Change: Q84*
SMART Domains Protein: ENSMUSP00000142188
Gene: ENSMUSG00000058407
AA Change: Q84*

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 6.1e-5 PFAM
Pfam:Thioredoxin 75 172 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194747
Predicted Effect probably null
Transcript: ENSMUST00000195032
AA Change: Q84*
SMART Domains Protein: ENSMUSP00000141595
Gene: ENSMUSG00000058407
AA Change: Q84*

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195247
AA Change: Q84*
SMART Domains Protein: ENSMUSP00000141609
Gene: ENSMUSG00000058407
AA Change: Q84*

DomainStartEndE-ValueType
Pfam:Phosducin 15 180 5.1e-8 PFAM
Pfam:Thioredoxin 75 172 9.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the thioredoxin family. The exact function of this protein is not known but it is associated with cell differentiation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Txndc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1807:Txndc9 UTSW 1 37994015 missense probably damaging 0.99
R4489:Txndc9 UTSW 1 37995790 nonsense probably null
R4742:Txndc9 UTSW 1 37987684 missense possibly damaging 0.90
R5020:Txndc9 UTSW 1 37995712 missense probably benign 0.44
R5341:Txndc9 UTSW 1 37987623 utr 3 prime probably benign
R6441:Txndc9 UTSW 1 37990218 missense possibly damaging 0.47
R6917:Txndc9 UTSW 1 37995806 missense probably benign 0.23
R7145:Txndc9 UTSW 1 37990296 missense probably damaging 0.98
R7686:Txndc9 UTSW 1 37987768 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGAAAGCACCTGTGAGCAC -3'
(R):5'- GGCATAGGAAAGCCAACTGC -3'

Sequencing Primer
(F):5'- CATCACCACGCAGGAACATGG -3'
(R):5'- CCAACTGCGGATGGGAAC -3'
Posted On2015-04-17