Incidental Mutation 'R3918:Fbln5'
ID307514
Institutional Source Beutler Lab
Gene Symbol Fbln5
Ensembl Gene ENSMUSG00000021186
Gene Namefibulin 5
SynonymsEVEC
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101746565-101819055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101750791 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 446 (G446D)
Ref Sequence ENSEMBL: ENSMUSP00000152680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021603] [ENSMUST00000222587]
Predicted Effect probably damaging
Transcript: ENSMUST00000021603
AA Change: G433D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021603
Gene: ENSMUSG00000021186
AA Change: G433D

DomainStartEndE-ValueType
EGF_like 42 86 4.71e-1 SMART
EGF_CA 127 167 4.81e-8 SMART
EGF_CA 168 206 2.31e-10 SMART
EGF_CA 207 246 5.31e-10 SMART
EGF_CA 247 287 2.22e-12 SMART
EGF_like 288 333 8.14e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222587
AA Change: G446D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted, extracellular matrix protein containing an Arg-Gly-Asp (RGD) motif and calcium-binding EGF-like domains. It promotes adhesion of endothelial cells through interaction of integrins and the RGD motif. It is prominently expressed in developing arteries but less so in adult vessels. However, its expression is reinduced in balloon-injured vessels and atherosclerotic lesions, notably in intimal vascular smooth muscle cells and endothelial cells. Therefore, the protein encoded by this gene may play a role in vascular development and remodeling. Defects in this gene are a cause of autosomal dominant cutis laxa, autosomal recessive cutis laxa type I (CL type I), and age-related macular degeneration type 3 (ARMD3). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus impairs elastic fiber development. Mutant mice exhibit loose skin, lung abnormalities leading to emphysema, and cardiovascular defects affecting the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Fbln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Fbln5 APN 12 101809916 missense probably damaging 0.98
IGL01357:Fbln5 APN 12 101750887 missense probably damaging 1.00
IGL01860:Fbln5 APN 12 101809869 missense probably damaging 1.00
IGL02567:Fbln5 APN 12 101761800 critical splice donor site probably null
R0368:Fbln5 UTSW 12 101809714 critical splice donor site probably null
R1080:Fbln5 UTSW 12 101750872 missense possibly damaging 0.90
R1606:Fbln5 UTSW 12 101765198 missense probably benign 0.04
R2107:Fbln5 UTSW 12 101771269 missense probably damaging 1.00
R2138:Fbln5 UTSW 12 101761920 missense probably benign 0.32
R3694:Fbln5 UTSW 12 101765252 missense probably benign 0.00
R4166:Fbln5 UTSW 12 101757359 missense probably damaging 1.00
R4626:Fbln5 UTSW 12 101760827 missense probably damaging 1.00
R5004:Fbln5 UTSW 12 101760821 missense probably damaging 0.99
R5264:Fbln5 UTSW 12 101757444 missense possibly damaging 0.94
R5364:Fbln5 UTSW 12 101771364 missense probably damaging 0.98
R5767:Fbln5 UTSW 12 101765209 missense probably damaging 0.97
R5889:Fbln5 UTSW 12 101765226 missense probably damaging 1.00
R5914:Fbln5 UTSW 12 101760743 missense possibly damaging 0.78
R6427:Fbln5 UTSW 12 101761822 missense possibly damaging 0.84
R7079:Fbln5 UTSW 12 101757408 missense probably damaging 1.00
R7343:Fbln5 UTSW 12 101760816 missense probably damaging 1.00
R7803:Fbln5 UTSW 12 101761818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGTCAAGATGCTAGGCTG -3'
(R):5'- AGACAGCATCCTCACTGAAGTTG -3'

Sequencing Primer
(F):5'- TGATGCCCCCAGGAGATATTCAG -3'
(R):5'- TGAAGTTGCTGCCACCAGAC -3'
Posted On2015-04-17