Incidental Mutation 'R3918:Pcdhb12'
ID307521
Institutional Source Beutler Lab
Gene Symbol Pcdhb12
Ensembl Gene ENSMUSG00000043458
Gene Nameprotocadherin beta 12
SynonymsPcdh3, PcdhbL, Pcdhb5F
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3918 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37435621-37438654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37437048 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 416 (W416R)
Ref Sequence ENSEMBL: ENSMUSP00000050357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055495] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000055495
AA Change: W416R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050357
Gene: ENSMUSG00000043458
AA Change: W416R

DomainStartEndE-ValueType
CA 53 130 1.67e-1 SMART
CA 154 239 3.69e-23 SMART
CA 263 343 6.56e-29 SMART
CA 366 447 5.9e-22 SMART
CA 471 557 4.24e-23 SMART
CA 587 668 1.01e-11 SMART
Pfam:Cadherin_C_2 685 768 4.8e-26 PFAM
low complexity region 778 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193629
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppp1r36 G A 12: 76,417,657 V10I probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Pcdhb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pcdhb12 APN 18 37436982 missense probably benign 0.44
IGL01309:Pcdhb12 APN 18 37436154 missense probably damaging 1.00
IGL01834:Pcdhb12 APN 18 37437639 missense probably damaging 1.00
IGL01893:Pcdhb12 APN 18 37437210 missense probably benign 0.01
IGL02617:Pcdhb12 APN 18 37437046 missense probably benign 0.43
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0238:Pcdhb12 UTSW 18 37436727 missense probably benign 0.00
R0309:Pcdhb12 UTSW 18 37436121 missense probably benign
R0392:Pcdhb12 UTSW 18 37436958 missense possibly damaging 0.60
R0494:Pcdhb12 UTSW 18 37438095 missense probably benign
R0531:Pcdhb12 UTSW 18 37437318 missense probably damaging 1.00
R0571:Pcdhb12 UTSW 18 37437208 missense probably damaging 1.00
R0737:Pcdhb12 UTSW 18 37437709 missense probably damaging 1.00
R0882:Pcdhb12 UTSW 18 37437322 missense probably damaging 1.00
R1253:Pcdhb12 UTSW 18 37435821 missense possibly damaging 0.65
R1300:Pcdhb12 UTSW 18 37437397 missense possibly damaging 0.45
R1334:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1424:Pcdhb12 UTSW 18 37438079 missense probably benign
R1513:Pcdhb12 UTSW 18 37437058 missense probably damaging 1.00
R1654:Pcdhb12 UTSW 18 37436701 missense probably damaging 1.00
R1717:Pcdhb12 UTSW 18 37436788 missense probably damaging 1.00
R1753:Pcdhb12 UTSW 18 37436671 missense probably damaging 0.98
R1774:Pcdhb12 UTSW 18 37436442 missense possibly damaging 0.52
R1893:Pcdhb12 UTSW 18 37437083 missense probably benign 0.24
R1901:Pcdhb12 UTSW 18 37437630 missense possibly damaging 0.67
R2114:Pcdhb12 UTSW 18 37436212 missense probably damaging 1.00
R2264:Pcdhb12 UTSW 18 37436805 missense probably damaging 0.99
R2915:Pcdhb12 UTSW 18 37437640 missense probably damaging 1.00
R3689:Pcdhb12 UTSW 18 37436074 missense probably benign 0.01
R4621:Pcdhb12 UTSW 18 37437160 missense probably benign
R4679:Pcdhb12 UTSW 18 37436949 missense probably damaging 1.00
R4709:Pcdhb12 UTSW 18 37437495 missense probably benign 0.08
R4904:Pcdhb12 UTSW 18 37437856 missense possibly damaging 0.80
R4953:Pcdhb12 UTSW 18 37436156 missense probably damaging 1.00
R5091:Pcdhb12 UTSW 18 37435854 nonsense probably null
R5130:Pcdhb12 UTSW 18 37435824 missense probably benign
R5204:Pcdhb12 UTSW 18 37436089 missense probably damaging 0.99
R5361:Pcdhb12 UTSW 18 37437046 missense probably damaging 1.00
R5417:Pcdhb12 UTSW 18 37436034 missense probably benign 0.00
R5979:Pcdhb12 UTSW 18 37437991 missense possibly damaging 0.94
R6117:Pcdhb12 UTSW 18 37435642 intron probably benign
R6258:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6260:Pcdhb12 UTSW 18 37436839 missense probably benign 0.00
R6270:Pcdhb12 UTSW 18 37436785 missense possibly damaging 0.68
R6623:Pcdhb12 UTSW 18 37437658 missense possibly damaging 0.54
R7288:Pcdhb12 UTSW 18 37436015 missense probably benign 0.07
R7733:Pcdhb12 UTSW 18 37437036 missense probably damaging 1.00
R7762:Pcdhb12 UTSW 18 37435924 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGATCAGGAAGCTCACAGTC -3'
(R):5'- CCTGAATCTGAGTCTGTGGCAC -3'

Sequencing Primer
(F):5'- AAATTCCGCCGAGACTGTAGTTG -3'
(R):5'- CACTGATGGTGCCTATATGCAG -3'
Posted On2015-04-17