Incidental Mutation 'R3918:Ppp1r36'
ID307513
Institutional Source Beutler Lab
Gene Symbol Ppp1r36
Ensembl Gene ENSMUSG00000052221
Gene Nameprotein phosphatase 1, regulatory subunit 36
Synonyms
MMRRC Submission 040816-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R3918 (G1)
Quality Score183
Status Not validated
Chromosome12
Chromosomal Location76417538-76439492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76417657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 10 (V10I)
Ref Sequence ENSEMBL: ENSMUSP00000152006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063977] [ENSMUST00000220187]
Predicted Effect probably benign
Transcript: ENSMUST00000063977
AA Change: V10I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069849
Gene: ENSMUSG00000052221
AA Change: V10I

DomainStartEndE-ValueType
Pfam:PPPI_inhib 52 402 5.7e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218732
Predicted Effect probably benign
Transcript: ENSMUST00000220187
AA Change: V10I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,040,142 I52T probably damaging Het
Adhfe1 G A 1: 9,576,216 R447H probably damaging Het
Ak7 A G 12: 105,710,256 K72E probably benign Het
Best2 T G 8: 85,009,724 D270A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Col18a1 T C 10: 77,053,358 M1721V probably benign Het
Ctnnal1 T C 4: 56,865,000 T39A possibly damaging Het
Dnah9 T A 11: 65,870,974 M3897L possibly damaging Het
Dysf G A 6: 84,186,509 probably null Het
Egf T C 3: 129,696,860 I395V probably null Het
Fbln5 C T 12: 101,750,791 G446D probably damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hmcn1 G C 1: 150,690,610 T2214S probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Lpin1 A G 12: 16,571,189 S266P probably benign Het
Marveld2 T C 13: 100,611,893 Q226R probably benign Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Myh13 G A 11: 67,329,238 E138K probably benign Het
Nsun2 A G 13: 69,630,680 T516A probably damaging Het
Ola1 A G 2: 73,142,339 V200A probably benign Het
Olfr994 A T 2: 85,430,730 V33D possibly damaging Het
Patj C A 4: 98,456,218 P20H probably damaging Het
Pcdhb12 T A 18: 37,437,048 W416R probably benign Het
Pcdhga9 G A 18: 37,738,942 R608H probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Rnf150 C T 8: 82,864,461 T151I probably benign Het
Tank G T 2: 61,643,786 probably null Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trappc13 T C 13: 104,161,082 T105A probably damaging Het
Txndc9 G A 1: 37,994,050 Q84* probably null Het
Ubr3 A T 2: 70,016,130 probably null Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zcchc6 A G 13: 59,782,024 S1066P probably damaging Het
Zfp51 A G 17: 21,463,440 K106E probably benign Het
Other mutations in Ppp1r36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Ppp1r36 APN 12 76439117 critical splice acceptor site probably null
IGL01744:Ppp1r36 APN 12 76439232 missense possibly damaging 0.83
IGL03295:Ppp1r36 APN 12 76438418 missense probably damaging 0.97
R0099:Ppp1r36 UTSW 12 76436282 splice site probably null
R0332:Ppp1r36 UTSW 12 76427903 missense probably benign 0.32
R0463:Ppp1r36 UTSW 12 76418967 missense probably damaging 0.98
R0491:Ppp1r36 UTSW 12 76439291 missense probably benign 0.01
R1664:Ppp1r36 UTSW 12 76436254 missense possibly damaging 0.84
R2011:Ppp1r36 UTSW 12 76418926 critical splice acceptor site probably null
R5352:Ppp1r36 UTSW 12 76428083 missense probably damaging 1.00
R5464:Ppp1r36 UTSW 12 76428078 critical splice acceptor site probably null
R5490:Ppp1r36 UTSW 12 76437986 missense probably damaging 0.98
R5490:Ppp1r36 UTSW 12 76437987 missense possibly damaging 0.85
R5523:Ppp1r36 UTSW 12 76438118 missense possibly damaging 0.71
R5844:Ppp1r36 UTSW 12 76426792 missense possibly damaging 0.71
R5849:Ppp1r36 UTSW 12 76439157 missense probably damaging 0.99
R5866:Ppp1r36 UTSW 12 76426805 missense possibly damaging 0.71
R5996:Ppp1r36 UTSW 12 76439162 missense possibly damaging 0.71
R6443:Ppp1r36 UTSW 12 76417639 missense probably benign
R6612:Ppp1r36 UTSW 12 76437604 missense possibly damaging 0.52
R6756:Ppp1r36 UTSW 12 76427922 missense probably benign 0.28
X0025:Ppp1r36 UTSW 12 76426810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATCAAAGCACAGCGTGAG -3'
(R):5'- CTCCCTATAGAGTCCCTACTGG -3'

Sequencing Primer
(F):5'- GCGTGTTACTGCAGGAAGC -3'
(R):5'- GACCAGGCTGCACTTAC -3'
Posted On2015-04-17