Incidental Mutation 'R3932:Clcc1'
ID308490
Institutional Source Beutler Lab
Gene Symbol Clcc1
Ensembl Gene ENSMUSG00000027884
Gene Namechloride channel CLIC-like 1
SynonymsMclc
MMRRC Submission 040919-MU
Accession Numbers

Ncbi RefSeq: NM_001177770.1, NM_145543.2, NM_001177771.1; MGI:2385186

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3932 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location108653913-108678840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108673366 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 332 (M332T)
Ref Sequence ENSEMBL: ENSMUSP00000102224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029483] [ENSMUST00000106609] [ENSMUST00000106613]
Predicted Effect probably damaging
Transcript: ENSMUST00000029483
AA Change: M327T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029483
Gene: ENSMUSG00000027884
AA Change: M327T

DomainStartEndE-ValueType
Pfam:MCLC 3 539 2e-266 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106609
AA Change: M327T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102220
Gene: ENSMUSG00000027884
AA Change: M327T

DomainStartEndE-ValueType
Pfam:MCLC 3 539 2e-266 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106613
AA Change: M332T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102224
Gene: ENSMUSG00000027884
AA Change: M332T

DomainStartEndE-ValueType
Pfam:MCLC 8 544 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156811
Meta Mutation Damage Score 0.6603 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show strain-dependent cerebellar granule cell death and peripheral motor axon degeneration. The peripheral neuropathy, neurogenic muscular atrophy and mild truncal ataxia observed on the C57BL/6J background is not found on the C3H/HeSnJ background. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted(1) Gene trapped(11)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,473,850 probably benign Het
Arl1 C T 10: 88,733,536 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp10a T C 7: 58,827,104 M1189T possibly damaging Het
BC051142 A G 17: 34,443,443 T86A possibly damaging Het
Bcl2l14 A G 6: 134,423,808 D64G probably damaging Het
Cdc34b G A 11: 94,742,615 V214M probably benign Het
Cfap54 T C 10: 92,829,757 T2985A probably benign Het
Coch T C 12: 51,603,338 I370T probably damaging Het
Ctdnep1 A G 11: 69,989,574 probably benign Het
Edar C T 10: 58,610,342 C221Y probably damaging Het
Fam135b T A 15: 71,450,431 Q1295L probably benign Het
Fam184a C T 10: 53,699,301 A71T probably damaging Het
Fbxw10 A G 11: 62,869,157 probably benign Het
Frmd4a T C 2: 4,537,260 W247R probably damaging Het
Gcn1l1 A G 5: 115,587,834 H553R probably benign Het
Grin3a C T 4: 49,672,472 probably null Het
H2-Q6 C T 17: 35,425,566 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspg2 T C 4: 137,515,568 V670A probably damaging Het
Med10 A G 13: 69,809,982 N18D probably damaging Het
Mgat4b T A 11: 50,233,338 H368Q possibly damaging Het
Morn5 C A 2: 36,053,023 T45N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Msl3 C T X: 168,671,817 A87T probably damaging Het
Myrf T C 19: 10,218,151 T432A probably damaging Het
Nav3 T A 10: 109,694,035 E2148D probably damaging Het
Nfe2l3 A G 6: 51,456,615 T236A possibly damaging Het
Odc1 T A 12: 17,548,800 F227Y probably benign Het
Olfr1444 T C 19: 12,862,630 M285T possibly damaging Het
Opa1 A T 16: 29,610,880 E401D probably damaging Het
Pdcd1 T C 1: 94,041,264 I110V probably benign Het
Pde5a G A 3: 122,760,896 E212K probably damaging Het
Plin4 A G 17: 56,106,704 I307T probably benign Het
Rag1 T C 2: 101,643,039 Y586C probably damaging Het
Rgs7bp T C 13: 105,052,998 M98V probably benign Het
Rgs9 A G 11: 109,275,813 probably benign Het
Rin3 A G 12: 102,390,083 D961G probably damaging Het
Rubcn A G 16: 32,829,259 probably null Het
Slc13a2 T A 11: 78,398,400 Y495F probably damaging Het
Tfec T A 6: 16,845,459 D67V probably damaging Het
Tmem28 G A X: 99,821,864 V266M possibly damaging Het
Tmem94 T C 11: 115,789,254 M30T probably benign Het
Tubgcp6 A G 15: 89,104,414 probably benign Het
Vmn2r10 C A 5: 109,002,222 A319S possibly damaging Het
Vmn2r85 T C 10: 130,418,467 M783V probably damaging Het
Zfp422 T C 6: 116,626,459 K193R probably benign Het
Zfp94 T G 7: 24,303,687 D110A probably benign Het
Other mutations in Clcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Clcc1 APN 3 108670903 missense probably benign 0.04
IGL01683:Clcc1 APN 3 108676796 missense probably benign 0.00
IGL02067:Clcc1 APN 3 108668721 missense probably damaging 0.99
IGL02341:Clcc1 APN 3 108673383 missense possibly damaging 0.60
B6584:Clcc1 UTSW 3 108672913 missense probably damaging 1.00
R0014:Clcc1 UTSW 3 108661396 nonsense probably null
R0733:Clcc1 UTSW 3 108674740 missense probably benign 0.00
R1151:Clcc1 UTSW 3 108668043 missense probably damaging 1.00
R1432:Clcc1 UTSW 3 108668102 missense probably benign 0.11
R3546:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3547:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R3548:Clcc1 UTSW 3 108668113 missense probably benign 0.00
R4210:Clcc1 UTSW 3 108663591 missense possibly damaging 0.90
R4211:Clcc1 UTSW 3 108663591 missense possibly damaging 0.90
R4756:Clcc1 UTSW 3 108672920 splice site probably null
R4856:Clcc1 UTSW 3 108676838 missense probably benign 0.02
R4886:Clcc1 UTSW 3 108676838 missense probably benign 0.02
R5858:Clcc1 UTSW 3 108661428 missense probably damaging 1.00
R6258:Clcc1 UTSW 3 108673308 missense possibly damaging 0.73
R6301:Clcc1 UTSW 3 108673366 missense probably damaging 1.00
R6414:Clcc1 UTSW 3 108676851 missense possibly damaging 0.90
R6944:Clcc1 UTSW 3 108670968 missense probably damaging 1.00
R6965:Clcc1 UTSW 3 108673309 missense probably damaging 0.99
R7331:Clcc1 UTSW 3 108668078 missense probably damaging 1.00
R7961:Clcc1 UTSW 3 108661458 missense probably damaging 1.00
R8009:Clcc1 UTSW 3 108661458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAGCGTCAGTGCACAG -3'
(R):5'- AAACTCGAGAACTTCTGATTAGAGG -3'

Sequencing Primer
(F):5'- CAGTGCACAGTGAAGTTTTGC -3'
(R):5'- TCACCTTATACGTGTAAGCACAG -3'
Posted On2015-04-17