Mutagenetix > Incidental Mutations

Incidental Mutation 'R0382:Usp48'

31008

Institutional Source

Beutler Lab

Gene Symbol

Usp48

Ensembl Gene

ENSMUSG00000043411

Gene Name

ubiquitin specific peptidase 48

Synonyms

Usp31, D330022K21Rik, 2810449C13Rik

MMRRC Submission

038588-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R0382 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

137593755-137658537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 137621218 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 536 (N536S)

Ref Sequence

ENSEMBL: ENSMUSP00000101466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105837] [ENSMUST00000105838] [ENSMUST00000105839] [ENSMUST00000105840]

Predicted Effect

probably benign
Transcript: ENSMUST00000055131
AA Change: N535S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: N535S

Domain	Start	End	E-Value	Type
Pfam:UCH	88	417	6.9e-44	PFAM
Pfam:UCH_1	89	374	1e-22	PFAM
Blast:DUSP	479	555	5e-39	BLAST
coiled coil region	622	643	N/A	INTRINSIC
UBQ	954	1022	4.78e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105837
AA Change: N10S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101463
Gene: ENSMUSG00000043411
AA Change: N10S

Domain	Start	End	E-Value	Type
Blast:DUSP	1	30	3e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105838
AA Change: N10S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101464
Gene: ENSMUSG00000043411
AA Change: N10S

Domain	Start	End	E-Value	Type
Blast:DUSP	1	30	3e-11	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105839
AA Change: N536S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101465
Gene: ENSMUSG00000043411
AA Change: N536S

Domain	Start	End	E-Value	Type
Pfam:UCH	88	418	3.2e-47	PFAM
Pfam:UCH_1	89	374	1.1e-25	PFAM
Blast:DUSP	480	556	5e-40	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105840
AA Change: N536S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: N536S

Domain	Start	End	E-Value	Type
Pfam:UCH	88	418	6.4e-49	PFAM
Pfam:UCH_1	89	374	1.8e-27	PFAM
Blast:DUSP	480	556	4e-39	BLAST
coiled coil region	624	645	N/A	INTRINSIC
Blast:DUSP	743	824	2e-7	BLAST
UBQ	938	1006	4.78e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128065

SMART Domains

Protein: ENSMUSP00000115533
Gene: ENSMUSG00000043411

Domain	Start	End	E-Value	Type
Blast:DUSP	9	111	2e-13	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138599

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152985

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154395

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	A	T	6: 86,946,919	Q266L	probably benign	Het
Abca13	T	C	11: 9,636,650		probably benign	Het
Adap2	T	C	11: 80,178,385		probably benign	Het
Adgrb2	C	G	4: 130,007,831	P416R	probably damaging	Het
Brinp1	T	C	4: 68,762,308	R662G	possibly damaging	Het
Celsr3	C	A	9: 108,829,218	P967T	probably damaging	Het
Ces1b	T	C	8: 93,076,052		probably benign	Het
Ckm	T	C	7: 19,421,384	*382Q	probably null	Het
Clec14a	A	G	12: 58,268,617	V73A	probably damaging	Het
Cmya5	A	T	13: 93,092,748	V1944E	probably benign	Het
Col6a6	T	A	9: 105,755,555	D1473V	probably damaging	Het
Cttnbp2	A	G	6: 18,435,343	M172T	probably benign	Het
Dcaf12	T	C	4: 41,302,672	N161S	probably damaging	Het
Dnah17	T	C	11: 118,128,996	Y75C	probably damaging	Het
Efcab7	T	C	4: 99,901,769	V388A	possibly damaging	Het
Fat3	A	G	9: 15,959,756	C3780R	probably damaging	Het
Fbxl14	T	C	6: 119,481,060	*401R	probably null	Het
Fbxo5	G	T	10: 5,801,176	Y270*	probably null	Het
Fnbp1l	A	T	3: 122,570,953		probably benign	Het
Fstl3	T	C	10: 79,777,307	S3P	probably benign	Het
Gpatch1	T	C	7: 35,301,655	D309G	probably damaging	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Klk6	A	G	7: 43,829,245	D192G	probably benign	Het
Lrp6	A	G	6: 134,467,668	S1080P	probably damaging	Het
Lztfl1	T	C	9: 123,707,906		probably null	Het
Mov10l1	A	G	15: 88,985,593	Y59C	possibly damaging	Het
Natd1	C	T	11: 60,906,913	R62H	probably damaging	Het
Obscn	T	C	11: 59,040,306	T5835A	probably damaging	Het
Olfr1052	A	G	2: 86,298,593	Y259C	probably damaging	Het
Olfr1183	A	T	2: 88,461,725	R147S	possibly damaging	Het
Olfr1354	T	A	10: 78,917,126	Y95*	probably null	Het
Olfr792	T	C	10: 129,541,014	I159T	probably benign	Het
P2rx2	T	A	5: 110,341,179	E289V	probably benign	Het
Patl1	T	A	19: 11,925,232		probably null	Het
Ptprf	A	G	4: 118,223,394		probably benign	Het
Qrfpr	C	T	3: 36,180,969	C253Y	possibly damaging	Het
Rad21l	A	T	2: 151,645,443	D540E	probably damaging	Het
Rbm45	T	A	2: 76,370,211	I28N	possibly damaging	Het
Rnf170	A	T	8: 26,125,899		probably benign	Het
Sgsm3	G	A	15: 81,008,314	W280*	probably null	Het
Slc9a9	A	T	9: 94,685,217	H113L	probably benign	Het
Slc9b2	G	T	3: 135,318,422	C78F	probably damaging	Het
Slfn10-ps	T	A	11: 83,029,534		noncoding transcript	Het
Slfn8	T	A	11: 83,004,556	I475F	probably damaging	Het
Stox2	A	G	8: 47,203,284		probably benign	Het
Strbp	A	T	2: 37,600,826	N472K	probably benign	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tmem39a	A	G	16: 38,591,398		probably benign	Het
Trpc4ap	A	G	2: 155,636,230	L664P	probably damaging	Het
Uap1	T	A	1: 170,161,482	M124L	probably benign	Het
Usp50	T	A	2: 126,777,928	I155F	probably damaging	Het
Utp4	T	C	8: 106,922,935	I672T	probably benign	Het
Vmn1r94	A	T	7: 20,167,653	M242K	possibly damaging	Het
Vmn2r45	T	G	7: 8,483,099	N397H	probably benign	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vps41	C	A	13: 18,827,727	H335N	probably benign	Het

Other mutations in Usp48

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01691:Usp48	APN	4	137623272	critical splice acceptor site	probably null
IGL01864:Usp48	APN	4	137639227	missense	possibly damaging	0.87
IGL02386:Usp48	APN	4	137604523	missense	possibly damaging	0.93
IGL03112:Usp48	APN	4	137608064	missense	probably damaging	1.00
IGL03114:Usp48	APN	4	137656125	missense	probably damaging	1.00
IGL03406:Usp48	APN	4	137639295	missense	possibly damaging	0.90
burlap	UTSW	4	137625276	missense	possibly damaging	0.77
fulfillment	UTSW	4	137638233	missense	probably damaging	1.00
hayao	UTSW	4	137633439	nonsense	probably null
Mei	UTSW	4	137606693	nonsense	probably null
miyazaki	UTSW	4	137608154	missense	probably damaging	1.00
promise	UTSW	4	137634921	missense	probably damaging	1.00
satsuki	UTSW	4	137633126	missense	possibly damaging	0.93
Totoro	UTSW	4	137594483	missense	probably damaging	0.99
IGL02796:Usp48	UTSW	4	137610718	missense	probably damaging	1.00
R0050:Usp48	UTSW	4	137613803	missense	probably damaging	1.00
R0333:Usp48	UTSW	4	137594483	missense	probably damaging	0.99
R0423:Usp48	UTSW	4	137616411	missense	probably benign
R0570:Usp48	UTSW	4	137633126	missense	possibly damaging	0.93
R0855:Usp48	UTSW	4	137608154	missense	probably damaging	1.00
R0943:Usp48	UTSW	4	137644470	missense	possibly damaging	0.92
R1367:Usp48	UTSW	4	137639295	missense	possibly damaging	0.90
R1367:Usp48	UTSW	4	137644463	missense	probably damaging	1.00
R1689:Usp48	UTSW	4	137656107	splice site	probably null
R1725:Usp48	UTSW	4	137633422	nonsense	probably null
R2520:Usp48	UTSW	4	137625251	missense	probably benign	0.05
R2965:Usp48	UTSW	4	137613762	missense	probably damaging	1.00
R2966:Usp48	UTSW	4	137613762	missense	probably damaging	1.00
R3026:Usp48	UTSW	4	137594444	missense	probably benign	0.06
R3963:Usp48	UTSW	4	137633439	nonsense	probably null
R4087:Usp48	UTSW	4	137623340	missense	possibly damaging	0.95
R4633:Usp48	UTSW	4	137634900	missense	probably damaging	0.96
R4677:Usp48	UTSW	4	137616381	missense	probably benign	0.16
R4735:Usp48	UTSW	4	137633369	nonsense	probably null
R4932:Usp48	UTSW	4	137615833	missense	probably benign	0.00
R4932:Usp48	UTSW	4	137615834	intron	probably null
R4935:Usp48	UTSW	4	137650358	missense	probably benign	0.42
R4952:Usp48	UTSW	4	137606693	nonsense	probably null
R5034:Usp48	UTSW	4	137606757	nonsense	probably null
R5153:Usp48	UTSW	4	137616362	missense	possibly damaging	0.68
R5443:Usp48	UTSW	4	137621221	missense	possibly damaging	0.78
R5591:Usp48	UTSW	4	137652652	intron	probably benign
R5825:Usp48	UTSW	4	137623378	missense	probably benign
R5889:Usp48	UTSW	4	137616412	missense	probably benign
R5955:Usp48	UTSW	4	137615818	missense	probably benign
R6089:Usp48	UTSW	4	137605818	missense	probably damaging	1.00
R6443:Usp48	UTSW	4	137613763	missense	probably damaging	1.00
R6473:Usp48	UTSW	4	137609108	critical splice donor site	probably null
R6482:Usp48	UTSW	4	137634921	missense	probably damaging	1.00
R6859:Usp48	UTSW	4	137625276	missense	possibly damaging	0.77
R6916:Usp48	UTSW	4	137638233	missense	probably damaging	1.00
R6977:Usp48	UTSW	4	137650360	missense	probably damaging	1.00
R7749:Usp48	UTSW	4	137650417	missense	probably damaging	1.00
R7759:Usp48	UTSW	4	137594452	missense	probably benign	0.25
R7767:Usp48	UTSW	4	137604645	critical splice donor site	probably null
R7881:Usp48	UTSW	4	137633455	missense	probably benign	0.00
R7897:Usp48	UTSW	4	137644428	missense	probably damaging	0.96
R7933:Usp48	UTSW	4	137605749	splice site	probably null
R7964:Usp48	UTSW	4	137633455	missense	probably benign	0.00
R7980:Usp48	UTSW	4	137644428	missense	probably damaging	0.96
RF002:Usp48	UTSW	4	137605795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGACTTTGAACAAAGCGTGGAC -3'
(R):5'- TTAAGCTGGCAAGCTACTGCGGAC -3'

Sequencing Primer
(F):5'- GGACAATGCCTTGTATCAGTCAG -3'
(R):5'- GCGGACGAGCCTCTCTAAG -3'

Posted On

2013-04-24