Incidental Mutation 'R6646:Lrrn2'
ID527963
Institutional Source Beutler Lab
Gene Symbol Lrrn2
Ensembl Gene ENSMUSG00000026443
Gene Nameleucine rich repeat protein 2, neuronal
SynonymsNLRR-2, 5730406J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6646 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location132880273-132940005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132939056 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 620 (P620S)
Ref Sequence ENSEMBL: ENSMUSP00000027706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027706]
Predicted Effect probably benign
Transcript: ENSMUST00000027706
AA Change: P620S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027706
Gene: ENSMUSG00000026443
AA Change: P620S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 28 73 2.22e-2 SMART
LRR 92 115 3.86e0 SMART
LRR 116 139 1.08e-1 SMART
LRR_TYP 140 163 3.21e-4 SMART
LRR 164 187 1.33e-1 SMART
LRR 188 211 5.89e1 SMART
LRR 212 235 1.66e1 SMART
LRR 236 259 4.98e-1 SMART
LRR 260 283 5.26e0 SMART
LRR 309 333 5.56e0 SMART
LRR 334 357 2.17e-1 SMART
LRRCT 369 421 3.13e-3 SMART
IGc2 436 504 9.99e-13 SMART
FN3 525 607 3.49e0 SMART
transmembrane domain 629 651 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159088
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194934
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leucine-rich repeat superfamily. This gene was found to be amplified and overexpressed in malignant gliomas. The encoded protein has homology with other proteins that function as cell-adhesion molecules or as signal transduction receptors and is a candidate for the target gene in the 1q32.1 amplicon in malignant gliomas. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibited numerous neurological abnormalities when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,296,830 E115D unknown Het
Ada G T 2: 163,735,423 N48K probably benign Het
Aldh1a7 C T 19: 20,699,911 A449T possibly damaging Het
Arhgef28 A G 13: 97,939,494 V1344A probably benign Het
Carmil3 A T 14: 55,507,930 E1371D probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Dedd2 T C 7: 25,203,613 D307G probably damaging Het
Dennd6b G T 15: 89,186,184 F427L probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Doc2a G A 7: 126,851,619 probably null Het
Dst A G 1: 34,268,807 T6503A possibly damaging Het
Ehmt1 A T 2: 24,806,310 I922K probably damaging Het
Gbp9 A G 5: 105,082,903 I385T probably benign Het
Gipc2 A T 3: 152,094,201 D297E possibly damaging Het
Krt6b T A 15: 101,677,214 Q428L probably damaging Het
Loxl4 T C 19: 42,598,781 D625G probably damaging Het
Msh6 T C 17: 87,986,442 V875A possibly damaging Het
Nebl T C 2: 17,376,685 T727A probably damaging Het
Obscn T C 11: 59,082,718 D1929G possibly damaging Het
Pard3b T C 1: 62,161,121 V273A probably benign Het
Pcdhb7 T A 18: 37,343,974 V721E possibly damaging Het
Plaa A T 4: 94,589,978 H82Q probably benign Het
Plcd1 T A 9: 119,075,032 Y278F probably damaging Het
Plxnb1 C A 9: 109,108,827 H1214N probably benign Het
Ptprg C A 14: 11,962,714 P171T probably damaging Het
Rela T G 19: 5,647,104 D446E probably damaging Het
Rpap1 T C 2: 119,780,131 I156V probably benign Het
Rpl15 T C 14: 18,270,040 Y59C probably damaging Het
Scx C A 15: 76,457,921 T107N probably damaging Het
Skint5 T A 4: 113,940,777 K203I possibly damaging Het
Slc16a6 C T 11: 109,453,162 M518I probably benign Het
Sorbs1 C T 19: 40,325,549 G940R probably damaging Het
Synm A T 7: 67,735,127 I487K probably damaging Het
Tcerg1l A T 7: 138,395,183 probably null Het
Vmn2r99 T G 17: 19,380,031 L439R probably damaging Het
Wdr75 T A 1: 45,799,087 L52Q probably damaging Het
Zswim2 T A 2: 83,915,784 R437* probably null Het
Other mutations in Lrrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Lrrn2 APN 1 132938358 missense possibly damaging 0.89
IGL01407:Lrrn2 APN 1 132937227 missense probably damaging 1.00
IGL01636:Lrrn2 APN 1 132937221 missense possibly damaging 0.95
IGL02134:Lrrn2 APN 1 132937817 missense possibly damaging 0.69
IGL02142:Lrrn2 APN 1 132939245 missense possibly damaging 0.86
IGL03240:Lrrn2 APN 1 132938327 missense possibly damaging 0.53
R0226:Lrrn2 UTSW 1 132937820 missense probably damaging 1.00
R0612:Lrrn2 UTSW 1 132937728 missense probably damaging 1.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1185:Lrrn2 UTSW 1 132939221 missense probably benign 0.00
R1969:Lrrn2 UTSW 1 132939234 missense probably benign 0.00
R2087:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
R3923:Lrrn2 UTSW 1 132938492 missense probably benign 0.45
R4006:Lrrn2 UTSW 1 132937740 missense probably damaging 1.00
R4022:Lrrn2 UTSW 1 132939114 missense probably benign
R4091:Lrrn2 UTSW 1 132937652 nonsense probably null
R4092:Lrrn2 UTSW 1 132937652 nonsense probably null
R4719:Lrrn2 UTSW 1 132939177 missense probably benign
R5285:Lrrn2 UTSW 1 132939245 missense possibly damaging 0.86
R5681:Lrrn2 UTSW 1 132937161 start gained probably benign
R5791:Lrrn2 UTSW 1 132937767 missense probably benign 0.00
R5916:Lrrn2 UTSW 1 132937800 missense probably damaging 1.00
R7021:Lrrn2 UTSW 1 132938784 missense probably damaging 1.00
R7686:Lrrn2 UTSW 1 132938594 missense probably benign 0.04
R7811:Lrrn2 UTSW 1 132939201 missense probably benign
R7869:Lrrn2 UTSW 1 132939378 missense unknown
R8004:Lrrn2 UTSW 1 132937751 missense probably damaging 1.00
R8195:Lrrn2 UTSW 1 132937344 missense probably damaging 1.00
Z1177:Lrrn2 UTSW 1 132937898 nonsense probably null
Z1177:Lrrn2 UTSW 1 132938978 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAACCTCACCTGGTCTAG -3'
(R):5'- ACAAGGGGTGCAGACACTAC -3'

Sequencing Primer
(F):5'- ACCTGGTCTAGCGCCTC -3'
(R):5'- GTGCAGACACTACCCGGACAG -3'
Posted On2018-07-24