Incidental Mutation 'R3962:Haus6'
ID312114
Institutional Source Beutler Lab
Gene Symbol Haus6
Ensembl Gene ENSMUSG00000038047
Gene NameHAUS augmin-like complex, subunit 6
Synonyms6230416J20Rik, D4Ertd27e
MMRRC Submission 040837-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.629) question?
Stock #R3962 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location86578855-86612055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86611804 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 4 (A4T)
Ref Sequence ENSEMBL: ENSMUSP00000118609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070607] [ENSMUST00000125481]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070607
AA Change: A4T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070504
Gene: ENSMUSG00000038047
AA Change: A4T

DomainStartEndE-ValueType
Pfam:HAUS6_N 14 238 1.1e-77 PFAM
low complexity region 613 624 N/A INTRINSIC
low complexity region 771 785 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123432
Predicted Effect possibly damaging
Transcript: ENSMUST00000125481
AA Change: A4T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118609
Gene: ENSMUSG00000038047
AA Change: A4T

DomainStartEndE-ValueType
Pfam:HAUS6_N 43 69 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128381
Meta Mutation Damage Score 0.0989 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E2.5 and E7.5 with delayed or incomplete clustering of microtubule-organizing centers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019N19Rik A G 19: 58,789,109 Y82H probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 A T 1: 71,274,515 probably null Het
Ablim2 C T 5: 35,812,175 R211C probably damaging Het
Actn4 C A 7: 28,898,222 probably null Het
AF529169 G A 9: 89,601,910 T478I probably damaging Het
B3gnt5 A G 16: 19,769,048 S6G probably benign Het
Bod1l T G 5: 41,808,721 E2667A probably benign Het
Ccdc13 G A 9: 121,798,939 probably benign Het
Ccdc15 G T 9: 37,320,486 R181S probably damaging Het
Ccnd1 G A 7: 144,934,050 T230M probably damaging Het
Cdcp1 T C 9: 123,182,381 T344A possibly damaging Het
Fam161a T C 11: 23,023,507 M275T possibly damaging Het
Fbxo15 A G 18: 84,959,247 T95A probably benign Het
Fndc5 T C 4: 129,139,895 V152A probably benign Het
Galk2 A T 2: 125,893,373 N107I probably benign Het
Glmn A T 5: 107,561,045 probably benign Het
Gm5082 T C 13: 41,656,418 noncoding transcript Het
Gm5828 C T 1: 16,768,644 noncoding transcript Het
Hmgcs2 G A 3: 98,291,038 V86M possibly damaging Het
Hrg G A 16: 22,956,075 V152I possibly damaging Het
Itga2 A T 13: 114,839,518 V1106E probably damaging Het
Itga9 G A 9: 118,628,186 D122N possibly damaging Het
Kif21a T A 15: 90,985,409 E413V probably damaging Het
Klk1 A G 7: 44,229,549 T256A possibly damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Larp4 C A 15: 100,012,145 Q652K probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Moxd2 T A 6: 40,885,397 M163L probably benign Het
Myo15 G A 11: 60,479,828 R1138H probably benign Het
Oasl2 A G 5: 114,897,747 D28G probably benign Het
Olfr777 A T 10: 129,268,666 I219N probably damaging Het
Platr26 A T 2: 71,719,505 noncoding transcript Het
Ptdss1 A G 13: 66,994,011 H411R probably benign Het
Ptpa A G 2: 30,435,660 T147A probably damaging Het
Rfx2 T C 17: 56,785,302 Y307C probably damaging Het
Rtn3 T C 19: 7,458,145 S142G probably damaging Het
Shisa6 A G 11: 66,217,476 V525A probably damaging Het
Slc4a3 A G 1: 75,556,754 S1007G probably damaging Het
Srsf3 C T 17: 29,036,456 probably benign Het
Taar8a A G 10: 24,077,156 I219M probably damaging Het
Tars2 A G 3: 95,754,756 probably null Het
Tfap2d A G 1: 19,118,965 N245S probably damaging Het
Tlr6 T A 5: 64,954,985 H193L probably benign Het
Tomm20l T C 12: 71,117,578 V78A probably benign Het
Tsc2 G A 17: 24,621,166 probably benign Het
Usp2 A G 9: 44,075,657 D84G possibly damaging Het
V1ra8 A G 6: 90,203,484 N223S probably benign Het
Wnk2 C A 13: 49,070,977 R1122L probably damaging Het
Other mutations in Haus6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Haus6 APN 4 86607981 missense probably benign 0.32
IGL02307:Haus6 APN 4 86583835 missense possibly damaging 0.53
IGL03113:Haus6 APN 4 86583106 nonsense probably null
IGL03384:Haus6 APN 4 86583525 missense probably benign
R0436:Haus6 UTSW 4 86585807 missense probably benign 0.00
R0491:Haus6 UTSW 4 86602846 missense possibly damaging 0.93
R0620:Haus6 UTSW 4 86583514 missense possibly damaging 0.53
R1118:Haus6 UTSW 4 86585326 critical splice donor site probably null
R1969:Haus6 UTSW 4 86604246 missense probably damaging 0.99
R1985:Haus6 UTSW 4 86593609 missense possibly damaging 0.96
R2213:Haus6 UTSW 4 86581992 missense possibly damaging 0.53
R2448:Haus6 UTSW 4 86589001 missense possibly damaging 0.53
R2567:Haus6 UTSW 4 86585885 nonsense probably null
R2760:Haus6 UTSW 4 86583176 nonsense probably null
R3714:Haus6 UTSW 4 86602867 missense probably benign 0.01
R4180:Haus6 UTSW 4 86583574 missense probably benign 0.00
R4736:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4738:Haus6 UTSW 4 86600749 critical splice donor site probably null
R4929:Haus6 UTSW 4 86595433 missense probably benign 0.03
R4933:Haus6 UTSW 4 86585287 intron probably benign
R5027:Haus6 UTSW 4 86605696 missense possibly damaging 0.92
R5199:Haus6 UTSW 4 86582985 missense possibly damaging 0.85
R5240:Haus6 UTSW 4 86583178 missense possibly damaging 0.86
R5580:Haus6 UTSW 4 86599266 missense possibly damaging 0.73
R5781:Haus6 UTSW 4 86601263 missense possibly damaging 0.92
R5865:Haus6 UTSW 4 86586357 missense possibly damaging 0.73
R5926:Haus6 UTSW 4 86599316 missense probably benign
R6154:Haus6 UTSW 4 86583756 missense possibly damaging 0.96
R7166:Haus6 UTSW 4 86583687 missense possibly damaging 0.72
R7183:Haus6 UTSW 4 86583752 missense possibly damaging 0.53
R7418:Haus6 UTSW 4 86594773 missense possibly damaging 0.73
R7843:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
R7926:Haus6 UTSW 4 86586341 missense possibly damaging 0.85
Z1088:Haus6 UTSW 4 86602874 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CATCCCTTACACTGGTGACG -3'
(R):5'- AGTGTAGTCTTCCGCAAGCG -3'

Sequencing Primer
(F):5'- CACAGGGTTCTGCCGCC -3'
(R):5'- AGCGCTGCAGTCACTGTC -3'
Posted On2015-04-29