Incidental Mutation 'R3974:Plod2'
ID312529
Institutional Source Beutler Lab
Gene Symbol Plod2
Ensembl Gene ENSMUSG00000032374
Gene Nameprocollagen lysine, 2-oxoglutarate 5-dioxygenase 2
SynonymsD530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location92542223-92608428 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 92598619 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 422 (G422*)
Ref Sequence ENSEMBL: ENSMUSP00000125373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]
Predicted Effect probably null
Transcript: ENSMUST00000070522
AA Change: G422*
SMART Domains Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: G422*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 563 736 6.38e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160359
AA Change: G422*
SMART Domains Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: G422*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 584 757 6.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190075
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Plod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Plod2 APN 9 92598614 missense probably damaging 0.99
IGL00945:Plod2 APN 9 92584496 missense probably benign 0.08
IGL01386:Plod2 APN 9 92606602 missense probably damaging 0.99
IGL01519:Plod2 APN 9 92595295 missense probably benign 0.00
IGL01836:Plod2 APN 9 92606498 splice site probably benign
IGL02490:Plod2 APN 9 92586842 missense probably benign 0.00
IGL02496:Plod2 APN 9 92607094 missense probably damaging 1.00
IGL02699:Plod2 APN 9 92607142 missense probably damaging 1.00
IGL02735:Plod2 APN 9 92595389 splice site probably benign
IGL03106:Plod2 APN 9 92573567 missense probably damaging 0.98
R0270:Plod2 UTSW 9 92584521 missense probably benign 0.10
R0546:Plod2 UTSW 9 92595335 missense probably damaging 1.00
R0589:Plod2 UTSW 9 92593746 missense probably benign
R0707:Plod2 UTSW 9 92605427 missense possibly damaging 0.91
R1491:Plod2 UTSW 9 92606584 missense probably benign 0.00
R1572:Plod2 UTSW 9 92603067 splice site probably benign
R1731:Plod2 UTSW 9 92584604 critical splice donor site probably null
R1895:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R1917:Plod2 UTSW 9 92581257 missense probably benign
R1946:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R3850:Plod2 UTSW 9 92542545 missense probably benign 0.28
R3973:Plod2 UTSW 9 92598619 nonsense probably null
R4289:Plod2 UTSW 9 92602988 missense possibly damaging 0.89
R4423:Plod2 UTSW 9 92601989 missense probably benign 0.00
R4647:Plod2 UTSW 9 92605450 nonsense probably null
R4754:Plod2 UTSW 9 92606531 nonsense probably null
R4769:Plod2 UTSW 9 92595272 missense probably damaging 1.00
R5279:Plod2 UTSW 9 92581323 missense probably damaging 1.00
R5535:Plod2 UTSW 9 92606569 missense probably damaging 1.00
R5654:Plod2 UTSW 9 92593823 missense probably benign
R5764:Plod2 UTSW 9 92603021 missense probably damaging 0.97
R5885:Plod2 UTSW 9 92606656 critical splice donor site probably null
R5940:Plod2 UTSW 9 92591397 missense probably benign 0.39
R6917:Plod2 UTSW 9 92593770 missense possibly damaging 0.87
R7109:Plod2 UTSW 9 92573597 missense probably damaging 1.00
R7221:Plod2 UTSW 9 92584527 missense probably damaging 1.00
R7311:Plod2 UTSW 9 92584558 missense probably damaging 1.00
Z1088:Plod2 UTSW 9 92603035 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGTGTTCAGTTTGCCAGTTAAACTAG -3'
(R):5'- CCAAGTTCTCAAATGTATCCTAAGC -3'

Sequencing Primer
(F):5'- ATCTATTGAAGAAAAGACGAAGAGAC -3'
(R):5'- TGTATCCTAAGCAAAATGAAGACAG -3'
Posted On2015-04-30