Incidental Mutation 'R4074:Glt6d1'
ID 316437
Institutional Source Beutler Lab
Gene Symbol Glt6d1
Ensembl Gene ENSMUSG00000036401
Gene Name glycosyltransferase 6 domain containing 1
Synonyms 4933411C14Rik
MMRRC Submission 040855-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R4074 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25683871-25705860 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25684139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 289 (D289G)
Ref Sequence ENSEMBL: ENSMUSP00000048642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038010]
AlphaFold Q2NKH9
Predicted Effect probably damaging
Transcript: ENSMUST00000038010
AA Change: D289G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048642
Gene: ENSMUSG00000036401
AA Change: D289G

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Glyco_transf_6 22 310 6.8e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143166
Meta Mutation Damage Score 0.1424 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GT6 glycosyltransferases gene family, which includes the ABO blood group (ABO; MIM 110300) and GLT6D1, shows a complex evolution pattern, with multiple events of gain and loss in different mammal species. In humans, the ABO gene is considered the sole functional member, although the O allele is null and is fixed in certain populations (summary by Casals et al. (2009) [PubMed 19218399]).[supplied by OMIM, Jan 2011]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,485,401 (GRCm39) E422G probably damaging Het
Ace3 A G 11: 105,888,040 (GRCm39) Y287C probably damaging Het
Adam34l A T 8: 44,079,387 (GRCm39) F279Y probably damaging Het
Albfm1 T A 5: 90,740,727 (GRCm39) probably null Het
Arfgap3 C T 15: 83,187,330 (GRCm39) A510T probably damaging Het
Atg12 A G 18: 46,870,491 (GRCm39) F92L probably benign Het
Axl A G 7: 25,463,336 (GRCm39) probably benign Het
Chgb C A 2: 132,635,847 (GRCm39) D596E possibly damaging Het
Cmtr2 T A 8: 110,947,849 (GRCm39) F53Y possibly damaging Het
Cnot10 A G 9: 114,452,015 (GRCm39) F254L possibly damaging Het
Crb2 G T 2: 37,676,855 (GRCm39) C251F probably damaging Het
Crybg3 A T 16: 59,376,120 (GRCm39) probably benign Het
Cytl1 A G 5: 37,892,940 (GRCm39) I17V unknown Het
D930020B18Rik A G 10: 121,492,123 (GRCm39) probably benign Het
Depp1 A G 6: 116,629,029 (GRCm39) N124S possibly damaging Het
Dnah11 A G 12: 118,009,413 (GRCm39) M2083T probably benign Het
Dst A G 1: 34,231,350 (GRCm39) E2656G probably benign Het
Dst T C 1: 34,267,542 (GRCm39) F4995L probably damaging Het
Egf C T 3: 129,529,618 (GRCm39) R264Q probably benign Het
Eps15l1 A G 8: 73,134,128 (GRCm39) I482T probably damaging Het
Eqtn A G 4: 94,808,199 (GRCm39) I201T possibly damaging Het
Ero1a A T 14: 45,529,893 (GRCm39) probably null Het
Etl4 T C 2: 20,814,030 (GRCm39) probably benign Het
Fcho1 T C 8: 72,163,013 (GRCm39) H672R probably damaging Het
Gm5134 T A 10: 75,844,365 (GRCm39) W574R probably damaging Het
Gm5414 T C 15: 101,533,988 (GRCm39) N332D probably benign Het
Gnb3 T A 6: 124,813,942 (GRCm39) E215D probably benign Het
Ighv1-30 C T 12: 114,781,021 (GRCm39) noncoding transcript Het
Ighv1-4 A G 12: 114,451,147 (GRCm39) S15P possibly damaging Het
Igkv1-133 T G 6: 67,702,505 (GRCm39) Y74* probably null Het
Il17f G A 1: 20,847,987 (GRCm39) probably benign Het
Itpr2 C T 6: 146,274,742 (GRCm39) probably null Het
Krtap31-1 T C 11: 99,799,058 (GRCm39) I87T possibly damaging Het
Lilra6 A T 7: 3,917,889 (GRCm39) F85Y probably benign Het
Lrig3 C T 10: 125,849,277 (GRCm39) T999I probably benign Het
Myh7b T C 2: 155,460,678 (GRCm39) I277T probably damaging Het
Myo3b T C 2: 70,119,808 (GRCm39) F984S probably damaging Het
Naip5 G A 13: 100,382,572 (GRCm39) R46W probably damaging Het
Nup205 T A 6: 35,168,975 (GRCm39) probably null Het
Or52e18 A T 7: 104,609,923 (GRCm39) N5K probably damaging Het
Pde11a C T 2: 76,168,242 (GRCm39) R237H probably damaging Het
Pdk4 T C 6: 5,491,865 (GRCm39) N69S probably benign Het
Pot1a T C 6: 25,752,356 (GRCm39) probably null Het
Pramel33 A T 5: 93,633,057 (GRCm39) M50K probably damaging Het
Psg23 A T 7: 18,341,043 (GRCm39) S404T possibly damaging Het
Rev1 T G 1: 38,093,319 (GRCm39) K1075T possibly damaging Het
Rrbp1 T G 2: 143,805,030 (GRCm39) Q1045P probably benign Het
Scg2 A C 1: 79,414,574 (GRCm39) F50V probably damaging Het
Sel1l3 A G 5: 53,311,629 (GRCm39) Y619H probably damaging Het
Slco1a5 A T 6: 142,213,950 (GRCm39) I57K possibly damaging Het
Srp72 C A 5: 77,146,098 (GRCm39) T633K probably benign Het
Swt1 A G 1: 151,270,520 (GRCm39) V565A probably benign Het
Tesk1 A G 4: 43,443,606 (GRCm39) I58V possibly damaging Het
Tm2d3 T A 7: 65,347,498 (GRCm39) L49* probably null Het
Tmprss11e T C 5: 86,863,502 (GRCm39) T188A possibly damaging Het
Tnxb A G 17: 34,890,845 (GRCm39) N396S probably benign Het
Tuba8 T A 6: 121,199,756 (GRCm39) S147T probably damaging Het
Usp8 A G 2: 126,594,290 (GRCm39) D822G probably damaging Het
Vmn2r13 T A 5: 109,304,566 (GRCm39) I622F probably damaging Het
Vmn2r24 A T 6: 123,764,374 (GRCm39) H417L possibly damaging Het
Zfp608 A T 18: 55,031,180 (GRCm39) V920E probably damaging Het
Zmym2 T C 14: 57,140,461 (GRCm39) L100P probably damaging Het
Other mutations in Glt6d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Glt6d1 APN 2 25,701,041 (GRCm39) missense probably damaging 1.00
IGL01722:Glt6d1 APN 2 25,684,431 (GRCm39) missense probably benign 0.02
IGL01734:Glt6d1 APN 2 25,684,505 (GRCm39) missense probably benign 0.01
R0010:Glt6d1 UTSW 2 25,684,739 (GRCm39) critical splice acceptor site probably null
R0010:Glt6d1 UTSW 2 25,684,739 (GRCm39) critical splice acceptor site probably null
R0039:Glt6d1 UTSW 2 25,684,739 (GRCm39) critical splice acceptor site probably null
R0079:Glt6d1 UTSW 2 25,684,739 (GRCm39) critical splice acceptor site probably null
R0082:Glt6d1 UTSW 2 25,684,739 (GRCm39) critical splice acceptor site probably null
R0197:Glt6d1 UTSW 2 25,684,082 (GRCm39) missense probably benign
R0432:Glt6d1 UTSW 2 25,684,739 (GRCm39) critical splice acceptor site probably null
R0525:Glt6d1 UTSW 2 25,684,280 (GRCm39) missense possibly damaging 0.96
R1494:Glt6d1 UTSW 2 25,684,260 (GRCm39) missense probably damaging 1.00
R1959:Glt6d1 UTSW 2 25,684,425 (GRCm39) missense probably damaging 1.00
R3720:Glt6d1 UTSW 2 25,685,179 (GRCm39) frame shift probably null
R5664:Glt6d1 UTSW 2 25,704,192 (GRCm39) missense probably benign 0.03
R7075:Glt6d1 UTSW 2 25,685,292 (GRCm39) missense probably benign 0.00
R7576:Glt6d1 UTSW 2 25,704,134 (GRCm39) missense probably benign 0.39
R9674:Glt6d1 UTSW 2 25,684,382 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTCTAGATTCAGTCAAGTTGGAC -3'
(R):5'- TGCCATTATAGGTGGAGTGC -3'

Sequencing Primer
(F):5'- TGCAAGAAAGAACAATTGATTTTGG -3'
(R):5'- CCATTATAGGTGGAGTGCCCTTTC -3'
Posted On 2015-05-15