Incidental Mutation 'R4074:Gnb3'
ID 316462
Institutional Source Beutler Lab
Gene Symbol Gnb3
Ensembl Gene ENSMUSG00000023439
Gene Name guanine nucleotide binding protein (G protein), beta 3
Synonyms
MMRRC Submission 040855-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4074 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124834240-124840275 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124836979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 215 (E215D)
Ref Sequence ENSEMBL: ENSMUSP00000024206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024206] [ENSMUST00000024270] [ENSMUST00000131847] [ENSMUST00000135127] [ENSMUST00000150120] [ENSMUST00000151674]
AlphaFold Q61011
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024206
AA Change: E215D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024206
Gene: ENSMUSG00000023439
AA Change: E215D

DomainStartEndE-ValueType
WD40 44 83 4.91e-8 SMART
WD40 86 125 1.61e-3 SMART
WD40 132 170 5.1e-6 SMART
WD40 173 212 3.99e-8 SMART
WD40 215 254 2.67e-9 SMART
WD40 263 298 2e-1 SMART
WD40 301 340 3.87e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129251
Predicted Effect probably benign
Transcript: ENSMUST00000131847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134637
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140233
Predicted Effect probably benign
Transcript: ENSMUST00000150120
Predicted Effect probably benign
Transcript: ENSMUST00000151674
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal light ON response and synaptic maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,480,590 E422G probably damaging Het
5830473C10Rik T A 5: 90,592,868 probably null Het
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Ace3 A G 11: 105,997,214 Y287C probably damaging Het
Arfgap3 C T 15: 83,303,129 A510T probably damaging Het
Atg12 A G 18: 46,737,424 F92L probably benign Het
Axl A G 7: 25,763,911 probably benign Het
Chgb C A 2: 132,793,927 D596E possibly damaging Het
Cmtr2 T A 8: 110,221,217 F53Y possibly damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Crb2 G T 2: 37,786,843 C251F probably damaging Het
Crybg3 A T 16: 59,555,757 probably benign Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
D930020B18Rik A G 10: 121,656,218 probably benign Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Dst T C 1: 34,228,461 F4995L probably damaging Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eps15l1 A G 8: 72,380,284 I482T probably damaging Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ero1l A T 14: 45,292,436 probably null Het
Etl4 T C 2: 20,809,219 probably benign Het
Fcho1 T C 8: 71,710,369 H672R probably damaging Het
Glt6d1 T C 2: 25,794,127 D289G probably damaging Het
Gm16427 A T 5: 93,485,198 M50K probably damaging Het
Gm5134 T A 10: 76,008,531 W574R probably damaging Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Gm5414 T C 15: 101,625,553 N332D probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Ighv1-4 A G 12: 114,487,527 S15P possibly damaging Het
Igkv1-133 T G 6: 67,725,521 Y74* probably null Het
Il17f G A 1: 20,777,763 probably benign Het
Itpr2 C T 6: 146,373,244 probably null Het
Krtap31-1 T C 11: 99,908,232 I87T possibly damaging Het
Lilra6 A T 7: 3,914,890 F85Y probably benign Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Myh7b T C 2: 155,618,758 I277T probably damaging Het
Myo3b T C 2: 70,289,464 F984S probably damaging Het
Naip5 G A 13: 100,246,064 R46W probably damaging Het
Nup205 T A 6: 35,192,040 probably null Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Pdk4 T C 6: 5,491,865 N69S probably benign Het
Pot1a T C 6: 25,752,357 probably null Het
Psg23 A T 7: 18,607,118 S404T possibly damaging Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Scg2 A C 1: 79,436,857 F50V probably damaging Het
Sel1l3 A G 5: 53,154,287 Y619H probably damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Swt1 A G 1: 151,394,769 V565A probably benign Het
Tesk1 A G 4: 43,443,606 I58V possibly damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Tnxb A G 17: 34,671,871 N396S probably benign Het
Tuba8 T A 6: 121,222,797 S147T probably damaging Het
Usp8 A G 2: 126,752,370 D822G probably damaging Het
Vmn2r13 T A 5: 109,156,700 I622F probably damaging Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zfp608 A T 18: 54,898,108 V920E probably damaging Het
Zmym2 T C 14: 56,903,004 L100P probably damaging Het
Other mutations in Gnb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gnb3 APN 6 124837255 missense probably damaging 0.98
IGL01707:Gnb3 APN 6 124839689 missense possibly damaging 0.56
IGL02412:Gnb3 APN 6 124837462 missense probably benign 0.23
IGL02606:Gnb3 APN 6 124837415 missense probably benign 0.01
IGL02627:Gnb3 APN 6 124834715 missense probably damaging 0.98
IGL02669:Gnb3 APN 6 124837725 missense probably benign 0.17
R0006:Gnb3 UTSW 6 124835804 unclassified probably benign
R0026:Gnb3 UTSW 6 124837417 missense probably benign 0.00
R0445:Gnb3 UTSW 6 124837255 missense possibly damaging 0.92
R0538:Gnb3 UTSW 6 124835696 nonsense probably null
R1801:Gnb3 UTSW 6 124835636 missense probably benign 0.13
R6715:Gnb3 UTSW 6 124837728 missense possibly damaging 0.94
R7146:Gnb3 UTSW 6 124836924 critical splice donor site probably null
R7689:Gnb3 UTSW 6 124837220 missense possibly damaging 0.82
R7884:Gnb3 UTSW 6 124837092 missense probably benign 0.00
R8198:Gnb3 UTSW 6 124837037 missense probably benign 0.10
R8529:Gnb3 UTSW 6 124837670 missense probably benign 0.32
X0017:Gnb3 UTSW 6 124837068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAGTGTGACTGAGTGGG -3'
(R):5'- ACATTTCTCTGTGATGGGCTC -3'

Sequencing Primer
(F):5'- AGCAGACACGGGATTCCTTG -3'
(R):5'- TGTGATGGGCTCCCTCTC -3'
Posted On 2015-05-15