Incidental Mutation 'R4075:8430408G22Rik'
ID316513
Institutional Source Beutler Lab
Gene Symbol 8430408G22Rik
Ensembl Gene ENSMUSG00000048489
Gene NameRIKEN cDNA 8430408G22 gene
SynonymsDepp
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location116650609-116652794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116652068 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 124 (N124S)
Ref Sequence ENSEMBL: ENSMUSP00000136165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035842] [ENSMUST00000067354] [ENSMUST00000178241] [ENSMUST00000203029] [ENSMUST00000204203] [ENSMUST00000204555] [ENSMUST00000204576]
Predicted Effect probably benign
Transcript: ENSMUST00000035842
SMART Domains Protein: ENSMUSP00000048267
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 1.36e-15 SMART
Pfam:Nore1-SARAH 276 315 1.7e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000067354
AA Change: N124S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070203
Gene: ENSMUSG00000048489
AA Change: N124S

DomainStartEndE-ValueType
Pfam:DEPP 25 205 1.1e-71 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178241
AA Change: N124S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136165
Gene: ENSMUSG00000048489
AA Change: N124S

DomainStartEndE-ValueType
Pfam:DEPP 25 205 5.5e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203029
SMART Domains Protein: ENSMUSP00000144786
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 46 57 N/A INTRINSIC
RA 173 263 8.7e-18 SMART
Pfam:Nore1-SARAH 276 303 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203634
Predicted Effect probably benign
Transcript: ENSMUST00000204203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204313
Predicted Effect probably benign
Transcript: ENSMUST00000204555
SMART Domains Protein: ENSMUSP00000145125
Gene: ENSMUSG00000048489

DomainStartEndE-ValueType
Pfam:DEPP 25 70 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204576
SMART Domains Protein: ENSMUSP00000145394
Gene: ENSMUSG00000042129

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The expression of this gene is induced by fasting as well as by progesterone. The protein encoded by this gene contains a t-synaptosome-associated protein receptor (SNARE) coiled-coil homology domain and a peroxisomal targeting signal. Production of the encoded protein leads to phosphorylation and activation of the transcription factor ELK1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele are viable and fertile and display normal heart and blood vessel development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in 8430408G22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1424:8430408G22Rik UTSW 6 116652005 missense possibly damaging 0.71
R1433:8430408G22Rik UTSW 6 116652262 missense possibly damaging 0.95
R1806:8430408G22Rik UTSW 6 116651722 missense possibly damaging 0.96
R1807:8430408G22Rik UTSW 6 116651722 missense possibly damaging 0.96
R1872:8430408G22Rik UTSW 6 116651722 missense possibly damaging 0.96
R1879:8430408G22Rik UTSW 6 116651722 missense possibly damaging 0.96
R2060:8430408G22Rik UTSW 6 116651722 missense possibly damaging 0.96
R2207:8430408G22Rik UTSW 6 116651722 missense possibly damaging 0.96
R4074:8430408G22Rik UTSW 6 116652068 missense possibly damaging 0.71
R4724:8430408G22Rik UTSW 6 116652135 nonsense probably null
R5229:8430408G22Rik UTSW 6 116652031 missense possibly damaging 0.86
R6737:8430408G22Rik UTSW 6 116652097 missense possibly damaging 0.51
R7049:8430408G22Rik UTSW 6 116652293 missense probably damaging 0.98
R7092:8430408G22Rik UTSW 6 116651788 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTGCTGGACAAGGTCACAG -3'
(R):5'- TCATGGATCACTGGGAGGTG -3'

Sequencing Primer
(F):5'- TGGACAAGGTCACAGCCCAG -3'
(R):5'- TGCAAATAGAGAGTACCTAGGATAC -3'
Posted On2015-05-15