Incidental Mutation 'R4075:Pidd1'
ID316525
Institutional Source Beutler Lab
Gene Symbol Pidd1
Ensembl Gene ENSMUSG00000025507
Gene Namep53 induced death domain protein 1
Synonyms1200011D09Rik, Lrdd, Pidd
MMRRC Submission 040974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4075 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141438113-141444025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141440826 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 453 (F453L)
Ref Sequence ENSEMBL: ENSMUSP00000101627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019226] [ENSMUST00000026580] [ENSMUST00000106005] [ENSMUST00000106006] [ENSMUST00000124266] [ENSMUST00000128703] [ENSMUST00000190068] [ENSMUST00000190882] [ENSMUST00000172654] [ENSMUST00000201822] [ENSMUST00000201710]
Predicted Effect probably benign
Transcript: ENSMUST00000019226
SMART Domains Protein: ENSMUSP00000019226
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 8.1e-26 PFAM
Pfam:Mito_carr 99 217 8.6e-19 PFAM
Pfam:Mito_carr 221 310 7.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000026580
AA Change: F453L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026580
Gene: ENSMUSG00000025507
AA Change: F453L

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:Peptidase_S68 426 459 3.5e-26 PFAM
Pfam:ZU5 463 551 5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106005
AA Change: F453L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101627
Gene: ENSMUSG00000025507
AA Change: F453L

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 150 1.66e1 SMART
LRR 152 174 9.48e0 SMART
LRR 175 197 1.81e1 SMART
LRR 198 220 5.56e0 SMART
LRR 221 243 8.67e-1 SMART
LRR 244 266 7.57e0 SMART
LRR 267 290 6.13e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Pfam:ZU5 328 422 6.6e-11 PFAM
Pfam:Peptidase_S68 426 458 5.2e-21 PFAM
Pfam:ZU5 463 546 6.5e-9 PFAM
low complexity region 563 574 N/A INTRINSIC
low complexity region 734 744 N/A INTRINSIC
DEATH 783 878 8.31e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106006
SMART Domains Protein: ENSMUSP00000101628
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.8e-26 PFAM
Pfam:Mito_carr 99 137 5.6e-8 PFAM
Pfam:Mito_carr 134 216 2.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124266
SMART Domains Protein: ENSMUSP00000122177
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 2.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128703
SMART Domains Protein: ENSMUSP00000139487
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
LRR 244 266 3.1e-2 SMART
LRR 267 286 1.3e-1 SMART
low complexity region 303 311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190303
Predicted Effect probably benign
Transcript: ENSMUST00000190068
SMART Domains Protein: ENSMUSP00000139957
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR 221 240 9.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190882
SMART Domains Protein: ENSMUSP00000139785
Gene: ENSMUSG00000025507

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
LRR 129 148 3.5e-1 SMART
LRR 152 171 1.4e-1 SMART
LRR 175 194 3.9e-2 SMART
LRR 198 217 8.7e-1 SMART
LRR_TYP 221 244 3.7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172654
SMART Domains Protein: ENSMUSP00000133928
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 1 54 6.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201822
SMART Domains Protein: ENSMUSP00000144213
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 70 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201710
SMART Domains Protein: ENSMUSP00000144231
Gene: ENSMUSG00000019082

DomainStartEndE-ValueType
Pfam:Mito_carr 4 98 1.7e-26 PFAM
Pfam:Mito_carr 99 217 2.3e-18 PFAM
Pfam:Mito_carr 221 311 5.7e-20 PFAM
Meta Mutation Damage Score 0.7281 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a leucine-rich repeat and a death domain. This protein has been shown to interact with other death domain proteins, such as Fas (TNFRSF6)-associated via death domain (FADD) and MAP-kinase activating death domain-containing protein (MADD), and thus may function as an adaptor protein in cell death-related signaling processes. The expression of the mouse counterpart of this gene has been found to be positively regulated by the tumor suppressor p53 and to induce cell apoptosis in response to DNA damage, which suggests a role for this gene as an effector of p53-dependent apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele were viable and did not show fertility problems, gender bias, other overt phenotype, or any gross abnormalities in histological assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,068 N124S possibly damaging Het
Acsm4 T A 7: 119,698,758 L206H probably benign Het
Adgrf5 T G 17: 43,450,195 V927G probably damaging Het
Agtr1a A G 13: 30,381,834 N294S probably damaging Het
Aspm T C 1: 139,474,285 L1229S probably damaging Het
Chmp7 A T 14: 69,732,281 V70E probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cubn A G 2: 13,313,999 V2963A possibly damaging Het
Dnah5 T A 15: 28,293,791 D1347E probably benign Het
Dsg1a T G 18: 20,340,070 N733K possibly damaging Het
Dst A G 1: 34,192,269 E2656G probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Fsip2 C T 2: 82,982,901 S3188L probably benign Het
Gm14085 T G 2: 122,514,411 V166G probably benign Het
Gm5346 A T 8: 43,626,350 F279Y probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Hormad1 T C 3: 95,578,203 M234T possibly damaging Het
Ifi44 A T 3: 151,745,976 N164K probably benign Het
Ikzf3 G T 11: 98,467,643 Y289* probably null Het
Il17rc A G 6: 113,481,197 D327G possibly damaging Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lce1l C T 3: 92,850,233 S106N unknown Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Map4k4 T C 1: 40,023,462 Y1196H probably damaging Het
Mtr C A 13: 12,215,412 probably null Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nxt1 A G 2: 148,675,732 D131G probably damaging Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1350 T C 7: 6,570,143 S51P probably benign Het
Olfr670 A T 7: 104,960,716 N5K probably damaging Het
Pcdh7 A G 5: 57,721,808 R902G probably damaging Het
Ptpn1 T A 2: 167,976,513 probably null Het
Rev1 T G 1: 38,054,238 K1075T possibly damaging Het
Slco1a5 A T 6: 142,268,224 I57K possibly damaging Het
Ssrp1 A C 2: 85,045,568 K590N possibly damaging Het
Svs2 T C 2: 164,237,318 E223G probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Tm2d3 T A 7: 65,697,750 L49* probably null Het
Usp31 A G 7: 121,667,782 probably null Het
Vmn2r24 A T 6: 123,787,415 H417L possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb11 C T 16: 55,998,064 T617I possibly damaging Het
Zfp677 T C 17: 21,398,159 Y493H probably damaging Het
Other mutations in Pidd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02751:Pidd1 APN 7 141439163 missense possibly damaging 0.93
IGL02794:Pidd1 APN 7 141443108 missense probably benign 0.00
IGL03083:Pidd1 APN 7 141440456 critical splice donor site probably null
IGL03347:Pidd1 APN 7 141439168 missense probably damaging 0.97
R0329:Pidd1 UTSW 7 141439561 unclassified probably benign
R0426:Pidd1 UTSW 7 141439133 missense probably damaging 1.00
R0650:Pidd1 UTSW 7 141440813 nonsense probably null
R0651:Pidd1 UTSW 7 141440813 nonsense probably null
R1201:Pidd1 UTSW 7 141440274 missense probably benign
R1221:Pidd1 UTSW 7 141438812 missense probably damaging 1.00
R1613:Pidd1 UTSW 7 141440777 missense probably damaging 1.00
R1763:Pidd1 UTSW 7 141439630 missense probably benign
R3967:Pidd1 UTSW 7 141439082 missense possibly damaging 0.86
R4072:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4073:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4076:Pidd1 UTSW 7 141440826 missense probably damaging 1.00
R4157:Pidd1 UTSW 7 141441366 missense possibly damaging 0.87
R4501:Pidd1 UTSW 7 141441443 unclassified probably benign
R4700:Pidd1 UTSW 7 141442249 missense probably damaging 1.00
R4797:Pidd1 UTSW 7 141442986 missense possibly damaging 0.92
R4985:Pidd1 UTSW 7 141438591 makesense probably null
R5402:Pidd1 UTSW 7 141438594 missense probably damaging 1.00
R5684:Pidd1 UTSW 7 141441111 splice site probably null
R5790:Pidd1 UTSW 7 141441392 unclassified probably benign
R5909:Pidd1 UTSW 7 141441270 missense probably damaging 1.00
R6275:Pidd1 UTSW 7 141439795 missense probably damaging 1.00
R6582:Pidd1 UTSW 7 141439581 missense probably damaging 1.00
R6814:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6872:Pidd1 UTSW 7 141439418 missense probably benign 0.34
R6935:Pidd1 UTSW 7 141440302 missense probably damaging 1.00
R7088:Pidd1 UTSW 7 141440487 missense probably damaging 1.00
R7133:Pidd1 UTSW 7 141439900 missense probably benign 0.05
R7544:Pidd1 UTSW 7 141440339 missense possibly damaging 0.81
R7821:Pidd1 UTSW 7 141442280 missense probably benign 0.36
R7861:Pidd1 UTSW 7 141440142 missense probably damaging 1.00
R7903:Pidd1 UTSW 7 141439831 missense probably damaging 0.99
R8218:Pidd1 UTSW 7 141439653 missense probably damaging 1.00
Z1176:Pidd1 UTSW 7 141440361 missense probably benign 0.03
Z1177:Pidd1 UTSW 7 141438696 missense probably damaging 1.00
Z1177:Pidd1 UTSW 7 141441016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGAACCATTTCAGTGCC -3'
(R):5'- ACCTAGAGACCCAACTGGAG -3'

Sequencing Primer
(F):5'- AGAACCATTTCAGTGCCCTCCTG -3'
(R):5'- CCCAACTGGAGGAAGAGGCAC -3'
Posted On2015-05-15