Incidental Mutation 'R4084:Olfr745'
ID317048
Institutional Source Beutler Lab
Gene Symbol Olfr745
Ensembl Gene ENSMUSG00000050028
Gene Nameolfactory receptor 745
SynonymsGA_x6K02T2PMLR-6361495-6362481, MOR106-11
MMRRC Submission 040857-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50639388-50643885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50642848 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 189 (I189N)
Ref Sequence ENSEMBL: ENSMUSP00000050184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062534] [ENSMUST00000213127] [ENSMUST00000218546]
Predicted Effect probably damaging
Transcript: ENSMUST00000062534
AA Change: I189N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050184
Gene: ENSMUSG00000050028
AA Change: I189N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:7tm_4 44 324 6.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 51 191 6.6e-6 PFAM
Pfam:7tm_1 57 306 1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206749
Predicted Effect probably damaging
Transcript: ENSMUST00000213127
AA Change: I183N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216105
Predicted Effect probably benign
Transcript: ENSMUST00000218546
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Capn13 C T 17: 73,337,449 G362R probably benign Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Cdon C A 9: 35,478,131 T844K probably damaging Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Hgf G T 5: 16,615,858 G668* probably null Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lamb2 A G 9: 108,488,018 N1291S probably benign Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lmtk3 T A 7: 45,793,292 S466R probably damaging Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc23a2 A T 2: 132,091,217 L107* probably null Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Slu7 G A 11: 43,443,391 A415T probably benign Het
Tlr5 A T 1: 182,974,848 R572S possibly damaging Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Olfr745
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Olfr745 APN 14 50643168 missense probably benign 0.02
IGL02316:Olfr745 APN 14 50642287 missense probably benign 0.25
IGL02377:Olfr745 APN 14 50642518 unclassified probably null
IGL02471:Olfr745 APN 14 50642757 missense probably benign 0.43
IGL02486:Olfr745 APN 14 50642632 missense probably damaging 1.00
IGL02517:Olfr745 APN 14 50643201 missense probably benign 0.01
R0453:Olfr745 UTSW 14 50643004 missense possibly damaging 0.90
R0727:Olfr745 UTSW 14 50643003 missense probably damaging 0.98
R0746:Olfr745 UTSW 14 50642775 unclassified probably null
R1638:Olfr745 UTSW 14 50643108 missense possibly damaging 0.93
R1688:Olfr745 UTSW 14 50643248 missense probably benign 0.04
R1991:Olfr745 UTSW 14 50642866 missense possibly damaging 0.90
R2245:Olfr745 UTSW 14 50642605 missense probably damaging 1.00
R3758:Olfr745 UTSW 14 50643036 missense possibly damaging 0.96
R5033:Olfr745 UTSW 14 50643162 missense probably damaging 1.00
R5211:Olfr745 UTSW 14 50643253 missense possibly damaging 0.78
R5302:Olfr745 UTSW 14 50642319 unclassified probably null
R5645:Olfr745 UTSW 14 50643067 missense probably benign 0.00
R5731:Olfr745 UTSW 14 50642791 missense probably damaging 1.00
R6917:Olfr745 UTSW 14 50643223 missense possibly damaging 0.67
R7408:Olfr745 UTSW 14 50642395 missense probably benign 0.16
R7716:Olfr745 UTSW 14 50642358 missense probably benign 0.17
R7728:Olfr745 UTSW 14 50642392 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAATAAGACCATCTCCTTCTCTGC -3'
(R):5'- AGTTCGACCAGCACCAGAAG -3'

Sequencing Primer
(F):5'- ACAACAGAGTGTTTCTTCTTGTCAGC -3'
(R):5'- GGAACTCGAAACACAGCTCTGAG -3'
Posted On2015-05-15