Incidental Mutation 'R4084:Tlr5'
ID317000
Institutional Source Beutler Lab
Gene Symbol Tlr5
Ensembl Gene ENSMUSG00000079164
Gene Nametoll-like receptor 5
Synonyms
MMRRC Submission 040857-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R4084 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location182954788-182976044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 182974848 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 572 (R572S)
Ref Sequence ENSEMBL: ENSMUSP00000141318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]
Predicted Effect probably benign
Transcript: ENSMUST00000110997
AA Change: R572S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: R572S

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 3.11e-2 SMART
LRR 159 183 5.56e0 SMART
LRR 184 207 1.97e2 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 7.05e-1 SMART
LRR 350 373 2.92e1 SMART
LRR 374 397 2.54e1 SMART
LRR 398 418 1.29e2 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 1.06e-4 SMART
LRR 540 563 6.13e-1 SMART
LRR 564 585 2.21e2 SMART
LRRCT 594 645 7.01e-6 SMART
low complexity region 657 676 N/A INTRINSIC
TIR 707 852 3.89e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191820
AA Change: R558S

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: R558S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 69 78 N/A INTRINSIC
LRR_TYP 95 118 1.3e-4 SMART
LRR 145 169 2.3e-2 SMART
LRR 170 193 8.2e-1 SMART
low complexity region 248 261 N/A INTRINSIC
LRR 312 335 2.9e-3 SMART
LRR 336 359 1.2e-1 SMART
LRR 360 383 1.1e-1 SMART
LRR 384 404 5.4e-1 SMART
low complexity region 427 442 N/A INTRINSIC
LRR_TYP 502 525 4.5e-7 SMART
LRR 526 549 2.5e-3 SMART
LRR 550 571 9.4e-1 SMART
LRRCT 580 631 3.4e-8 SMART
transmembrane domain 642 664 N/A INTRINSIC
TIR 693 838 2.5e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193539
Predicted Effect possibly damaging
Transcript: ENSMUST00000193687
AA Change: R572S

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: R572S

DomainStartEndE-ValueType
low complexity region 83 92 N/A INTRINSIC
LRR_TYP 109 132 1.3e-4 SMART
LRR 159 183 2.3e-2 SMART
LRR 184 207 8.2e-1 SMART
low complexity region 262 275 N/A INTRINSIC
LRR 326 349 2.9e-3 SMART
LRR 350 373 1.2e-1 SMART
LRR 374 397 1.1e-1 SMART
LRR 398 418 5.4e-1 SMART
low complexity region 441 456 N/A INTRINSIC
LRR_TYP 516 539 4.5e-7 SMART
LRR 540 563 2.5e-3 SMART
LRR 564 585 9.4e-1 SMART
LRRCT 594 645 3.4e-8 SMART
transmembrane domain 656 678 N/A INTRINSIC
TIR 707 852 2.5e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195614
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amotl2 A T 9: 102,724,685 probably null Het
Arhgdig T C 17: 26,199,825 D114G possibly damaging Het
Btnl1 C T 17: 34,381,159 T212I possibly damaging Het
Camkk1 C T 11: 73,037,865 T410I probably damaging Het
Capn13 C T 17: 73,337,449 G362R probably benign Het
Catsperd A G 17: 56,654,453 T392A probably benign Het
Ccdc180 A G 4: 45,950,632 I1626V probably benign Het
Cdon C A 9: 35,478,131 T844K probably damaging Het
Col28a1 G A 6: 8,013,131 Q974* probably null Het
Col28a1 C G 6: 8,013,132 K973N possibly damaging Het
Dnhd1 T C 7: 105,709,588 L3428P probably damaging Het
Ecm1 A T 3: 95,734,363 N519K probably damaging Het
Fbxw11 T C 11: 32,739,248 V457A probably damaging Het
Flna C T X: 74,236,925 V1009M possibly damaging Het
Fmnl2 A T 2: 53,107,495 K486I possibly damaging Het
Gja1 A C 10: 56,388,511 Q322P possibly damaging Het
Gm14124 T A 2: 150,266,202 N27K possibly damaging Het
Gtpbp3 A G 8: 71,490,512 Q189R probably benign Het
H2-Eb1 T C 17: 34,314,443 V213A probably damaging Het
Herc4 G T 10: 63,283,237 G322V probably damaging Het
Hgf G T 5: 16,615,858 G668* probably null Het
Htra1 T C 7: 130,936,344 S25P probably benign Het
Ifi44 A G 3: 151,745,489 probably null Het
Klhl24 T A 16: 20,114,562 S308T probably damaging Het
Lamb2 A G 9: 108,488,018 N1291S probably benign Het
Lgals9 A T 11: 78,969,763 F162Y possibly damaging Het
Lig3 T A 11: 82,795,424 I634N probably damaging Het
Lipn T C 19: 34,078,940 F229L probably benign Het
Lmtk3 T A 7: 45,793,292 S466R probably damaging Het
Lonrf2 G A 1: 38,821,151 T22I probably benign Het
Macf1 T C 4: 123,450,072 H2119R probably damaging Het
Muc6 C T 7: 141,648,655 C634Y probably damaging Het
Nap1l1 G A 10: 111,490,077 V86I possibly damaging Het
Noxred1 A G 12: 87,233,484 Y25H possibly damaging Het
Nphp4 T C 4: 152,488,791 L62P probably damaging Het
Olfr1359 G A 13: 21,703,068 W22* probably null Het
Olfr1359 C A 13: 21,703,069 L23M probably damaging Het
Olfr599 T G 7: 103,338,320 F89V probably damaging Het
Olfr745 T A 14: 50,642,848 I189N probably damaging Het
Pcdh10 A C 3: 45,392,707 D979A probably damaging Het
Pla2g4f C G 2: 120,312,325 Q101H probably benign Het
Ppp1r15b T C 1: 133,133,067 F441L probably damaging Het
Prkaca C A 8: 83,995,310 P309T probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ripor3 A G 2: 167,984,466 Y720H possibly damaging Het
Rpgrip1 A G 14: 52,149,351 E751G possibly damaging Het
Rsf1 GCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,919 probably benign Het
Ryr3 A G 2: 112,900,908 S686P probably damaging Het
Seh1l T C 18: 67,788,790 V240A possibly damaging Het
Slc10a2 T G 8: 5,089,126 I273L possibly damaging Het
Slc23a2 A T 2: 132,091,217 L107* probably null Het
Slc44a4 T C 17: 34,917,347 L38P probably damaging Het
Slc6a18 C T 13: 73,667,029 V387I probably benign Het
Slu7 G A 11: 43,443,391 A415T probably benign Het
Tmem45a2 C T 16: 57,071,024 G3D probably benign Het
Trim24 A G 6: 37,915,257 T242A probably damaging Het
Triobp T A 15: 78,973,671 N1157K probably benign Het
Ugt1a6a A T 1: 88,139,177 D235V probably benign Het
Vmn2r37 C T 7: 9,215,985 V467I probably benign Het
Vmn2r7 C T 3: 64,692,993 E495K probably benign Het
Vstm2a A G 11: 16,263,098 E161G probably damaging Het
Ypel3 T C 7: 126,778,365 V74A possibly damaging Het
Zfp27 C T 7: 29,895,367 R391H possibly damaging Het
Other mutations in Tlr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tlr5 APN 1 182973829 missense probably benign
IGL00940:Tlr5 APN 1 182974196 missense possibly damaging 0.84
IGL01302:Tlr5 APN 1 182974748 missense probably benign 0.00
IGL01480:Tlr5 APN 1 182973499 missense probably benign 0.09
IGL01717:Tlr5 APN 1 182975398 missense probably damaging 1.00
IGL01896:Tlr5 APN 1 182974879 missense possibly damaging 0.64
IGL02083:Tlr5 APN 1 182973884 missense possibly damaging 0.91
IGL02135:Tlr5 APN 1 182973254 missense possibly damaging 0.82
R0464:Tlr5 UTSW 1 182973710 missense probably benign 0.01
R0552:Tlr5 UTSW 1 182975696 unclassified probably null
R0556:Tlr5 UTSW 1 182974151 missense probably damaging 1.00
R0639:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R0670:Tlr5 UTSW 1 182973889 missense probably damaging 1.00
R1014:Tlr5 UTSW 1 182975677 missense probably benign 0.00
R1125:Tlr5 UTSW 1 182973892 missense probably benign 0.00
R1563:Tlr5 UTSW 1 182975010 missense probably benign 0.09
R1775:Tlr5 UTSW 1 182973722 missense probably damaging 0.99
R1793:Tlr5 UTSW 1 182972447 missense probably benign 0.00
R1991:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R1992:Tlr5 UTSW 1 182974347 missense probably damaging 1.00
R2114:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2116:Tlr5 UTSW 1 182975629 missense probably damaging 1.00
R2225:Tlr5 UTSW 1 182972376 start gained probably benign
R2265:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2266:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2268:Tlr5 UTSW 1 182975035 missense possibly damaging 0.63
R2882:Tlr5 UTSW 1 182973893 missense probably damaging 1.00
R3695:Tlr5 UTSW 1 182975347 missense probably damaging 1.00
R3747:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R3749:Tlr5 UTSW 1 182974439 missense probably benign 0.01
R4794:Tlr5 UTSW 1 182973896 missense probably benign 0.00
R4895:Tlr5 UTSW 1 182974199 missense probably damaging 1.00
R4964:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R4966:Tlr5 UTSW 1 182973473 missense probably benign 0.07
R5496:Tlr5 UTSW 1 182973632 missense probably damaging 1.00
R6056:Tlr5 UTSW 1 182974038 missense possibly damaging 0.76
R6715:Tlr5 UTSW 1 182972659 intron probably benign
R6825:Tlr5 UTSW 1 182973044 intron probably benign
R6961:Tlr5 UTSW 1 182973511 nonsense probably null
R7135:Tlr5 UTSW 1 182975523 missense possibly damaging 0.87
R7232:Tlr5 UTSW 1 182973499 missense probably benign 0.09
R7255:Tlr5 UTSW 1 182974316 missense probably damaging 1.00
R7257:Tlr5 UTSW 1 182974233 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAATATGCTGCAGCTGGC -3'
(R):5'- GCAGTGAGTTAGGGTACATGC -3'

Sequencing Primer
(F):5'- GGGATGTTTTTCAAGGCCTTTCCC -3'
(R):5'- TAGGGTACATGCAATACACGTCTGC -3'
Posted On2015-05-15