Incidental Mutation 'R4085:Styxl1'
ID317079
Institutional Source Beutler Lab
Gene Symbol Styxl1
Ensembl Gene ENSMUSG00000019178
Gene Nameserine/threonine/tyrosine interacting-like 1
Synonyms1700011C14Rik, Dusp24
MMRRC Submission 040979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4085 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135747220-135778385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135759165 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 92 (T92I)
Ref Sequence ENSEMBL: ENSMUSP00000136983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053906] [ENSMUST00000111161] [ENSMUST00000111162] [ENSMUST00000111163] [ENSMUST00000111164] [ENSMUST00000142343] [ENSMUST00000177559] [ENSMUST00000178515] [ENSMUST00000178796]
Predicted Effect silent
Transcript: ENSMUST00000053906
SMART Domains Protein: ENSMUSP00000051216
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect silent
Transcript: ENSMUST00000111161
SMART Domains Protein: ENSMUSP00000106791
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
DSPc 23 163 1.01e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000111162
AA Change: T92I
SMART Domains Protein: ENSMUSP00000106792
Gene: ENSMUSG00000019178
AA Change: T92I

DomainStartEndE-ValueType
Pfam:DSPc 64 203 2.5e-18 PFAM
Predicted Effect silent
Transcript: ENSMUST00000111163
SMART Domains Protein: ENSMUSP00000106793
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect silent
Transcript: ENSMUST00000111164
SMART Domains Protein: ENSMUSP00000106794
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142343
AA Change: T92I
SMART Domains Protein: ENSMUSP00000136983
Gene: ENSMUSG00000019178
AA Change: T92I

DomainStartEndE-ValueType
Blast:RHOD 17 62 8e-19 BLAST
SCOP:d1gmxa_ 23 67 6e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000177559
SMART Domains Protein: ENSMUSP00000135982
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
RHOD 17 148 1.31e-3 SMART
DSPc 167 307 1.01e-17 SMART
Predicted Effect silent
Transcript: ENSMUST00000178515
SMART Domains Protein: ENSMUSP00000137191
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
DSPc 23 163 1.01e-17 SMART
Predicted Effect silent
Transcript: ENSMUST00000178796
SMART Domains Protein: ENSMUSP00000137481
Gene: ENSMUSG00000019178

DomainStartEndE-ValueType
RHOD 27 158 1.31e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abca15 T C 7: 120,382,726 V1088A probably damaging Het
Adgrl3 A G 5: 81,512,544 I319V probably benign Het
Atraid A T 5: 31,052,306 probably benign Het
Aurkaip1 A T 4: 155,832,905 K172N probably benign Het
Bicd2 T A 13: 49,384,962 probably null Het
Ccr1 C T 9: 123,963,950 R181H probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cldn34c4 A T X: 127,721,388 V153E probably damaging Het
Col4a4 C A 1: 82,471,188 probably null Het
Coro1b T C 19: 4,153,619 V451A probably benign Het
Dcc T A 18: 71,826,169 Q177H probably benign Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dynlrb1 G T 2: 155,249,976 probably benign Het
Ehbp1 A T 11: 22,095,898 L592Q possibly damaging Het
Fam20b T C 1: 156,705,875 D57G probably benign Het
Fbxo33 A G 12: 59,200,805 probably benign Het
Fndc4 A G 5: 31,293,777 I190T probably damaging Het
Gad1 G T 2: 70,589,848 A359S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm43517 A G 12: 49,391,114 probably benign Het
Hectd1 A T 12: 51,774,750 V1052D possibly damaging Het
Herc6 G A 6: 57,647,069 C608Y probably benign Het
Itpr2 T A 6: 146,144,248 D2573V probably damaging Het
Kank2 A G 9: 21,795,119 L201P probably damaging Het
Kdm1a A C 4: 136,551,962 Y762* probably null Het
Mef2c C T 13: 83,575,702 T9M probably damaging Het
Ndst4 A G 3: 125,609,482 I413V probably benign Het
Nlrp1b T C 11: 71,161,762 T947A probably damaging Het
Nlrp5 C A 7: 23,430,098 N863K probably damaging Het
Olfr1383 T C 11: 49,524,128 I135T probably benign Het
Opn1sw A G 6: 29,380,144 I91T possibly damaging Het
Pmfbp1 A G 8: 109,494,947 K15E possibly damaging Het
Ppp3cb A G 14: 20,508,543 C484R possibly damaging Het
Rassf2 C A 2: 132,004,379 G153C probably damaging Het
Rbm15b T C 9: 106,885,737 N411D possibly damaging Het
Rbm47 A G 5: 66,022,737 M409T probably benign Het
Sall1 C T 8: 89,028,509 V1281M probably benign Het
Sall3 A T 18: 80,972,133 M860K probably damaging Het
Sik2 A T 9: 50,935,385 probably benign Het
Sim2 A G 16: 94,109,354 Y205C possibly damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taok2 T C 7: 126,874,725 E403G possibly damaging Het
Tedc2 A T 17: 24,219,839 V168E probably benign Het
Tle6 A G 10: 81,594,515 probably null Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Ucp1 T C 8: 83,293,951 I130T probably benign Het
Urb2 A G 8: 124,030,941 H1129R probably benign Het
Vmn2r111 C T 17: 22,559,115 G528R probably benign Het
Wbp2nl A G 15: 82,308,561 M149V probably benign Het
Xdh A T 17: 73,916,879 M506K probably benign Het
Other mutations in Styxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Styxl1 APN 5 135765750 missense probably damaging 1.00
IGL02735:Styxl1 APN 5 135759142 missense probably damaging 1.00
IGL03284:Styxl1 APN 5 135757095 missense possibly damaging 0.65
R1263:Styxl1 UTSW 5 135753883 missense probably damaging 1.00
R1533:Styxl1 UTSW 5 135770321 missense probably damaging 1.00
R1987:Styxl1 UTSW 5 135757122 missense probably damaging 1.00
R2399:Styxl1 UTSW 5 135747781 missense possibly damaging 0.80
R3040:Styxl1 UTSW 5 135757033 missense probably damaging 1.00
R3411:Styxl1 UTSW 5 135765764 missense probably damaging 1.00
R4772:Styxl1 UTSW 5 135768901 nonsense probably null
R5667:Styxl1 UTSW 5 135757123 unclassified probably null
R6376:Styxl1 UTSW 5 135747810 missense probably benign 0.04
R6601:Styxl1 UTSW 5 135755496 missense probably benign 0.30
R7588:Styxl1 UTSW 5 135770276 missense probably damaging 0.98
R7735:Styxl1 UTSW 5 135759169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGCTCGGAATCTGTCAGC -3'
(R):5'- CTGAGTAATTGCTTTCAGTGGAAG -3'

Sequencing Primer
(F):5'- CTCGGAATCTGTCAGCATGGG -3'
(R):5'- GAAGTGGCCATCCATTGTCAC -3'
Posted On2015-05-15