Incidental Mutation 'R4214:Gpr162'
ID319338
Institutional Source Beutler Lab
Gene Symbol Gpr162
Ensembl Gene ENSMUSG00000038390
Gene NameG protein-coupled receptor 162
SynonymsA-2, Grca
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4214 (G1)
Quality Score117
Status Validated
Chromosome6
Chromosomal Location124858444-124863983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124860068 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 338 (W338R)
Ref Sequence ENSEMBL: ENSMUSP00000145267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024044] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024044
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000046893
AA Change: W338R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390
AA Change: W338R

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204253
Predicted Effect probably damaging
Transcript: ENSMUST00000204667
AA Change: W338R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390
AA Change: W338R

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Meta Mutation Damage Score 0.9332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified upon genomic analysis of a gene-dense region at human chromosome 12p13. It appears to be mainly expressed in the brain; however, its function is not known. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Fez1 A G 9: 36,870,488 N20S probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Gpr162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Gpr162 APN 6 124858857 splice site probably null
IGL01879:Gpr162 APN 6 124861241 missense probably damaging 1.00
IGL01901:Gpr162 APN 6 124861407 missense possibly damaging 0.95
IGL01930:Gpr162 APN 6 124861612 missense possibly damaging 0.82
IGL02334:Gpr162 APN 6 124861160 missense probably damaging 1.00
R1036:Gpr162 UTSW 6 124860860 missense probably damaging 0.99
R1322:Gpr162 UTSW 6 124858901 missense probably damaging 0.96
R1351:Gpr162 UTSW 6 124861198 missense probably damaging 1.00
R1549:Gpr162 UTSW 6 124860088 missense probably damaging 1.00
R1933:Gpr162 UTSW 6 124861447 missense probably damaging 0.98
R4367:Gpr162 UTSW 6 124861695 start gained probably benign
R4628:Gpr162 UTSW 6 124861442 missense probably benign 0.03
R5290:Gpr162 UTSW 6 124861269 missense probably benign 0.17
R5354:Gpr162 UTSW 6 124859637 missense probably benign 0.06
R5404:Gpr162 UTSW 6 124861643 missense possibly damaging 0.73
R5465:Gpr162 UTSW 6 124861171 missense probably damaging 1.00
R5520:Gpr162 UTSW 6 124860913 missense probably damaging 1.00
R5566:Gpr162 UTSW 6 124860938 nonsense probably null
R6184:Gpr162 UTSW 6 124861241 missense probably damaging 1.00
R6450:Gpr162 UTSW 6 124861189 missense possibly damaging 0.84
R6685:Gpr162 UTSW 6 124861531 missense probably damaging 1.00
R6807:Gpr162 UTSW 6 124861201 missense probably damaging 0.97
R6972:Gpr162 UTSW 6 124861309 missense probably damaging 0.99
R6982:Gpr162 UTSW 6 124860956 missense probably damaging 1.00
R7543:Gpr162 UTSW 6 124861392 nonsense probably null
R7650:Gpr162 UTSW 6 124861843 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCATCAAAGGAAACAGGGCTTG -3'
(R):5'- GACCAGCCATTGCCTATTCC -3'

Sequencing Primer
(F):5'- CTTGGATGGACAAGTCATCAGGC -3'
(R):5'- CTATTCCCCGTCAGGTGGTGAG -3'
Posted On2015-06-10