Incidental Mutation 'R4319:Gm2663'
ID324128
Institutional Source Beutler Lab
Gene Symbol Gm2663
Ensembl Gene ENSMUSG00000096525
Gene Namepredicted gene 2663
Synonyms
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4319 (G1)
Quality Score109
Status Not validated
Chromosome6
Chromosomal Location40995830-40999479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40997596 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 87 (Q87K)
Ref Sequence ENSEMBL: ENSMUSP00000130465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166306]
Predicted Effect probably damaging
Transcript: ENSMUST00000166306
AA Change: Q87K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130465
Gene: ENSMUSG00000096525
AA Change: Q87K

DomainStartEndE-ValueType
Tryp_SPc 23 240 3.04e-97 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Klf2 A G 8: 72,320,161 T270A probably benign Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Gm2663
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Gm2663 APN 6 40996076 missense probably damaging 1.00
IGL02200:Gm2663 APN 6 40996013 missense probably benign 0.00
R1222:Gm2663 UTSW 6 40996041 missense probably benign
R1726:Gm2663 UTSW 6 40998026 missense probably damaging 1.00
R1779:Gm2663 UTSW 6 40997960 missense probably damaging 0.98
R2018:Gm2663 UTSW 6 40997966 missense probably benign 0.01
R4321:Gm2663 UTSW 6 40997596 missense probably damaging 1.00
R4776:Gm2663 UTSW 6 40995953 missense probably damaging 1.00
R7149:Gm2663 UTSW 6 40997957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGTATTTCCCCAGCCAG -3'
(R):5'- CTGAACATTGGCTGTAAGGC -3'

Sequencing Primer
(F):5'- CAGAAACAAGGCACTGAGCATTTG -3'
(R):5'- TTCATAGCCCTGACAGTACTGGATG -3'
Posted On2015-06-24