Mutagenetix > Incidental Mutation

Incidental Mutation 'R4319:Sox6'

324133

Institutional Source

Beutler Lab

Gene Symbol

Sox6

Ensembl Gene

ENSMUSG00000051910

Gene Name

SRY (sex determining region Y)-box 6

Synonyms

MMRRC Submission

041660-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4319 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115470872-116038796 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 115580563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145931 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]

AlphaFold

P40645

Predicted Effect

probably null
Transcript: ENSMUST00000072804

SMART Domains

Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106612

SMART Domains

Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
low complexity region	420	442	N/A	INTRINSIC
low complexity region	465	475	N/A	INTRINSIC
HMG	577	647	1.5e-25	SMART
low complexity region	755	767	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166207

SMART Domains

Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000166877

SMART Domains

Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000169129

SMART Domains

Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000205405

Predicted Effect

probably benign
Transcript: ENSMUST00000205479

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205980

Predicted Effect

probably null
Transcript: ENSMUST00000206034

Predicted Effect

probably null
Transcript: ENSMUST00000206369

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206775

Meta Mutation Damage Score

0.9485

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

94% (31/33)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atxn7l2	A	T	3: 108,205,832	D218E	probably damaging	Het
Bahd1	C	T	2: 118,916,406	P169S	probably damaging	Het
Cacna1c	A	C	6: 118,654,369	I1148S	probably damaging	Het
Ccdc178	T	A	18: 22,033,543	K530*	probably null	Het
Ccdc191	A	G	16: 43,947,509	E624G	probably damaging	Het
Cep290	A	C	10: 100,539,047	H1385P	probably benign	Het
Chrd	A	G	16: 20,737,048	H545R	probably damaging	Het
Dgkb	A	G	12: 38,438,599	I655V	probably damaging	Het
Gm15448	A	G	7: 3,822,755	S372P	possibly damaging	Het
Gm2663	G	T	6: 40,997,596	Q87K	probably damaging	Het
Itsn1	G	A	16: 91,818,552		probably benign	Het
Kif11	T	C	19: 37,384,585	V84A	probably damaging	Het
Klf2	A	G	8: 72,320,161	T270A	probably benign	Het
Lemd2	A	G	17: 27,201,677	M254T	possibly damaging	Het
Luc7l	A	T	17: 26,277,619		probably benign	Het
Mapk11	T	C	15: 89,146,743	E71G	probably damaging	Het
Mcoln2	G	A	3: 146,150,011		probably null	Het
Olfr1392	G	A	11: 49,293,676	M118I	probably damaging	Het
Pygb	G	T	2: 150,815,614		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Spty2d1	T	C	7: 46,998,135	S349G	probably damaging	Het
Srbd1	A	T	17: 86,051,150	V657D	probably damaging	Het
Tspo2	G	T	17: 48,449,843		probably benign	Het
Ufsp2	A	G	8: 45,995,627	T422A	possibly damaging	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Wdr46	A	G	17: 33,940,744	T3A	probably benign	Het

Other mutations in Sox6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Sox6	APN	7	115477206	missense	probably benign
IGL00957:Sox6	APN	7	115777092	missense	probably damaging	1.00
IGL01624:Sox6	APN	7	115476968	missense	probably damaging	1.00
IGL02057:Sox6	APN	7	115550075	missense	probably damaging	1.00
IGL02385:Sox6	APN	7	115550039	missense	possibly damaging	0.77
IGL02410:Sox6	APN	7	115486744	missense	probably damaging	1.00
IGL02736:Sox6	APN	7	115580640	missense	probably damaging	1.00
IGL02747:Sox6	APN	7	115489746	missense	probably damaging	1.00
IGL02792:Sox6	APN	7	115541649	missense	probably benign
PIT4480001:Sox6	UTSW	7	115597509	missense	probably benign	0.03
R0458:Sox6	UTSW	7	115489794	missense	probably damaging	1.00
R0689:Sox6	UTSW	7	115486551	missense	probably damaging	1.00
R0800:Sox6	UTSW	7	115579014	critical splice donor site	probably null
R1220:Sox6	UTSW	7	115662442	missense	probably damaging	1.00
R1474:Sox6	UTSW	7	115701691	splice site	probably benign
R1547:Sox6	UTSW	7	115701722	missense	possibly damaging	0.93
R1570:Sox6	UTSW	7	115777123	missense	probably damaging	1.00
R1674:Sox6	UTSW	7	115801419	missense	probably benign	0.00
R1704:Sox6	UTSW	7	115476948	missense	possibly damaging	0.92
R1754:Sox6	UTSW	7	115477055	missense	probably benign
R1833:Sox6	UTSW	7	115777093	missense	probably damaging	1.00
R1868:Sox6	UTSW	7	115659538	missense	possibly damaging	0.89
R1893:Sox6	UTSW	7	115544568	missense	probably benign	0.28
R2386:Sox6	UTSW	7	115597505	missense	probably damaging	1.00
R2431:Sox6	UTSW	7	115550007	splice site	probably null
R4303:Sox6	UTSW	7	115544469	critical splice donor site	probably null
R4320:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4321:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4323:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4335:Sox6	UTSW	7	115512724	missense	probably benign
R4567:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R4776:Sox6	UTSW	7	115541670	missense	probably damaging	1.00
R4838:Sox6	UTSW	7	115486662	missense	probably damaging	1.00
R4914:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R4915:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R5184:Sox6	UTSW	7	115777228	missense	probably damaging	1.00
R5372:Sox6	UTSW	7	115550151	nonsense	probably null
R5454:Sox6	UTSW	7	115701773	missense	possibly damaging	0.89
R5663:Sox6	UTSW	7	115550054	missense	probably benign
R5685:Sox6	UTSW	7	115579157	splice site	probably null
R5734:Sox6	UTSW	7	115541621	critical splice donor site	probably null
R6020:Sox6	UTSW	7	115486628	missense	probably damaging	1.00
R6211:Sox6	UTSW	7	115801462	missense	probably damaging	1.00
R6263:Sox6	UTSW	7	115477060	missense	probably damaging	1.00
R6549:Sox6	UTSW	7	115486692	missense	possibly damaging	0.79
R6576:Sox6	UTSW	7	115701702	missense	probably damaging	0.96
R6680:Sox6	UTSW	7	115476983	missense	possibly damaging	0.94
R6709:Sox6	UTSW	7	115701789	splice site	probably null
R6747:Sox6	UTSW	7	115541731	missense	probably damaging	1.00
R6755:Sox6	UTSW	7	115662442	missense	probably damaging	0.99
R7233:Sox6	UTSW	7	115489809	missense	possibly damaging	0.80
R7423:Sox6	UTSW	7	115550023	missense	probably benign	0.30
R7455:Sox6	UTSW	7	115489669	missense	probably benign	0.02
R7522:Sox6	UTSW	7	115801578	missense	probably damaging	1.00
R7527:Sox6	UTSW	7	115777173	missense	probably benign	0.00
R7852:Sox6	UTSW	7	115801604	start codon destroyed	probably null	1.00
R7936:Sox6	UTSW	7	115544595	missense	probably benign
R8278:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R8335:Sox6	UTSW	7	115701714	missense	probably damaging	1.00
R8558:Sox6	UTSW	7	115541798	missense	probably benign	0.12
R8682:Sox6	UTSW	7	115476956	missense	probably damaging	1.00
R8693:Sox6	UTSW	7	115662397	missense	probably damaging	0.99
R8712:Sox6	UTSW	7	115597508	missense	probably benign	0.00
R8972:Sox6	UTSW	7	115476983	nonsense	probably null
R9297:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9318:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9517:Sox6	UTSW	7	115512735	missense	possibly damaging	0.79
R9688:Sox6	UTSW	7	115476990	missense	probably benign
X0061:Sox6	UTSW	7	115477148	missense	probably benign	0.00
X0065:Sox6	UTSW	7	115550108	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTTTAAAGCCGGCTGGAAC -3'
(R):5'- AAGCCTTTTGTTTCTGCAGATG -3'

Sequencing Primer
(F):5'- GCTGGAACTGGCACCTTTC -3'
(R):5'- CAATGTTGTAAAGCTCAGGCGATCC -3'

Posted On

2015-06-24