Incidental Mutation 'R4319:Chrd'
ID 324141
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Name chordin
Synonyms Chd
MMRRC Submission 041660-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4319 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20551877-20561134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20555798 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 545 (H545R)
Ref Sequence ENSEMBL: ENSMUSP00000156080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000232646] [ENSMUST00000231698]
AlphaFold Q9Z0E2
Predicted Effect probably damaging
Transcript: ENSMUST00000007171
AA Change: H523R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: H523R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115423
AA Change: H523R

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958
AA Change: H523R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115437
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151150
Predicted Effect probably benign
Transcript: ENSMUST00000153299
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
Predicted Effect probably damaging
Transcript: ENSMUST00000232646
AA Change: H545R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000231698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232104
Meta Mutation Damage Score 0.3905 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,113,148 (GRCm39) D218E probably damaging Het
Bahd1 C T 2: 118,746,887 (GRCm39) P169S probably damaging Het
Cacna1c A C 6: 118,631,330 (GRCm39) I1148S probably damaging Het
Ccdc178 T A 18: 22,166,600 (GRCm39) K530* probably null Het
Ccdc191 A G 16: 43,767,872 (GRCm39) E624G probably damaging Het
Cep290 A C 10: 100,374,909 (GRCm39) H1385P probably benign Het
Dgkb A G 12: 38,488,598 (GRCm39) I655V probably damaging Het
Gm2663 G T 6: 40,974,530 (GRCm39) Q87K probably damaging Het
Itsn1 G A 16: 91,615,440 (GRCm39) probably benign Het
Kif11 T C 19: 37,373,033 (GRCm39) V84A probably damaging Het
Klf2 A G 8: 73,074,005 (GRCm39) T270A probably benign Het
Lemd2 A G 17: 27,420,651 (GRCm39) M254T possibly damaging Het
Luc7l A T 17: 26,496,593 (GRCm39) probably benign Het
Mapk11 T C 15: 89,030,946 (GRCm39) E71G probably damaging Het
Mcoln2 G A 3: 145,855,766 (GRCm39) probably null Het
Or2y1f G A 11: 49,184,503 (GRCm39) M118I probably damaging Het
Pira13 A G 7: 3,825,754 (GRCm39) S372P possibly damaging Het
Pygb G T 2: 150,657,534 (GRCm39) probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sox6 A G 7: 115,179,798 (GRCm39) probably null Het
Spty2d1 T C 7: 46,647,883 (GRCm39) S349G probably damaging Het
Srbd1 A T 17: 86,358,578 (GRCm39) V657D probably damaging Het
Tspo2 G T 17: 48,756,871 (GRCm39) probably benign Het
Ufsp2 A G 8: 46,448,664 (GRCm39) T422A possibly damaging Het
Vmn2r63 A G 7: 42,576,406 (GRCm39) F469S probably benign Het
Wdr46 A G 17: 34,159,718 (GRCm39) T3A probably benign Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20,559,975 (GRCm39) missense possibly damaging 0.89
IGL01486:Chrd APN 16 20,552,890 (GRCm39) splice site probably null
IGL02120:Chrd APN 16 20,553,291 (GRCm39) missense probably damaging 1.00
IGL02370:Chrd APN 16 20,554,541 (GRCm39) missense possibly damaging 0.52
IGL02675:Chrd APN 16 20,558,699 (GRCm39) splice site probably benign
IGL02678:Chrd APN 16 20,552,770 (GRCm39) missense probably damaging 1.00
IGL02874:Chrd APN 16 20,553,946 (GRCm39) missense probably damaging 1.00
ANU74:Chrd UTSW 16 20,560,069 (GRCm39) missense possibly damaging 0.88
PIT1430001:Chrd UTSW 16 20,557,748 (GRCm39) critical splice donor site probably null
R0016:Chrd UTSW 16 20,553,058 (GRCm39) missense possibly damaging 0.85
R0230:Chrd UTSW 16 20,552,025 (GRCm39) missense probably benign 0.25
R0605:Chrd UTSW 16 20,554,189 (GRCm39) missense probably damaging 1.00
R0831:Chrd UTSW 16 20,560,059 (GRCm39) missense probably damaging 0.99
R1501:Chrd UTSW 16 20,556,283 (GRCm39) missense probably damaging 1.00
R1659:Chrd UTSW 16 20,554,581 (GRCm39) missense probably damaging 0.96
R1766:Chrd UTSW 16 20,556,191 (GRCm39) missense probably damaging 1.00
R1823:Chrd UTSW 16 20,560,097 (GRCm39) splice site probably benign
R3001:Chrd UTSW 16 20,556,195 (GRCm39) nonsense probably null
R3002:Chrd UTSW 16 20,556,195 (GRCm39) nonsense probably null
R3874:Chrd UTSW 16 20,557,660 (GRCm39) missense probably damaging 0.99
R4587:Chrd UTSW 16 20,557,325 (GRCm39) missense possibly damaging 0.58
R4707:Chrd UTSW 16 20,557,558 (GRCm39) missense possibly damaging 0.58
R4857:Chrd UTSW 16 20,557,508 (GRCm39) missense possibly damaging 0.79
R5204:Chrd UTSW 16 20,554,822 (GRCm39) missense probably benign 0.02
R5364:Chrd UTSW 16 20,551,898 (GRCm39) start codon destroyed probably null 0.03
R5445:Chrd UTSW 16 20,557,660 (GRCm39) missense possibly damaging 0.74
R5611:Chrd UTSW 16 20,557,724 (GRCm39) missense probably damaging 1.00
R5940:Chrd UTSW 16 20,553,336 (GRCm39) missense probably null 0.01
R6004:Chrd UTSW 16 20,553,987 (GRCm39) missense possibly damaging 0.92
R6767:Chrd UTSW 16 20,557,376 (GRCm39) missense probably benign 0.00
R6798:Chrd UTSW 16 20,553,056 (GRCm39) missense probably damaging 1.00
R6801:Chrd UTSW 16 20,554,497 (GRCm39) missense possibly damaging 0.68
R6823:Chrd UTSW 16 20,553,486 (GRCm39) missense probably damaging 1.00
R6999:Chrd UTSW 16 20,554,402 (GRCm39) missense probably benign
R7069:Chrd UTSW 16 20,558,183 (GRCm39) missense probably damaging 1.00
R7136:Chrd UTSW 16 20,553,272 (GRCm39) missense possibly damaging 0.82
R7273:Chrd UTSW 16 20,560,316 (GRCm39) missense probably benign 0.32
R7558:Chrd UTSW 16 20,557,304 (GRCm39) missense probably damaging 1.00
R7813:Chrd UTSW 16 20,554,155 (GRCm39) missense probably benign 0.00
R7965:Chrd UTSW 16 20,557,903 (GRCm39) missense probably benign 0.05
R8361:Chrd UTSW 16 20,557,487 (GRCm39) missense possibly damaging 0.92
R8549:Chrd UTSW 16 20,560,027 (GRCm39) missense probably benign 0.40
R8809:Chrd UTSW 16 20,553,270 (GRCm39) missense probably benign 0.19
R8841:Chrd UTSW 16 20,554,487 (GRCm39) splice site probably benign
R9027:Chrd UTSW 16 20,555,737 (GRCm39) missense probably damaging 1.00
R9166:Chrd UTSW 16 20,554,572 (GRCm39) missense probably benign 0.28
R9255:Chrd UTSW 16 20,558,801 (GRCm39) missense probably damaging 1.00
R9618:Chrd UTSW 16 20,552,378 (GRCm39) missense probably damaging 1.00
X0063:Chrd UTSW 16 20,556,314 (GRCm39) critical splice donor site probably null
Z1088:Chrd UTSW 16 20,560,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTGAAAGTGAGAGGGCTC -3'
(R):5'- GGCTTGGGGAATAGCAAGTC -3'

Sequencing Primer
(F):5'- GAGGGCTCATCCTTCTTTGAC -3'
(R):5'- GGGAATAGCAAGTCTTAGCTTCC -3'
Posted On 2015-06-24