Incidental Mutation 'R4319:Klf2'
ID324135
Institutional Source Beutler Lab
Gene Symbol Klf2
Ensembl Gene ENSMUSG00000055148
Gene NameKruppel-like factor 2 (lung)
SynonymsLklf
MMRRC Submission 041660-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4319 (G1)
Quality Score157
Status Validated
Chromosome8
Chromosomal Location72319033-72321656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72320161 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 270 (T270A)
Ref Sequence ENSEMBL: ENSMUSP00000064823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067912]
Predicted Effect probably benign
Transcript: ENSMUST00000067912
AA Change: T270A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000064823
Gene: ENSMUSG00000055148
AA Change: T270A

DomainStartEndE-ValueType
low complexity region 57 88 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
ZnF_C2H2 271 295 1.03e-2 SMART
ZnF_C2H2 301 325 4.61e-5 SMART
ZnF_C2H2 331 353 1.69e-3 SMART
Meta Mutation Damage Score 0.0933 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 94% (31/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kruppel-like factors (KLFs) are a family of broadly expressed zinc finger transcription factors. KLF2 regulates T-cell trafficking by promoting expression of the lipid-binding receptor S1P1 (S1PR1; MIM 601974) and the selectin CD62L (SELL; MIM 153240) (summary by Weinreich et al., 2009 [PubMed 19592277]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for targeted null mutations die during organogenesis with growth retardation, massive hemorrhage, and signs of anemia. Mice homozygous for one allele also display craniofacial malformations and impaired hematopoiesis. A second allele causes vascular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cacna1c A C 6: 118,654,369 I1148S probably damaging Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cep290 A C 10: 100,539,047 H1385P probably benign Het
Chrd A G 16: 20,737,048 H545R probably damaging Het
Dgkb A G 12: 38,438,599 I655V probably damaging Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Gm2663 G T 6: 40,997,596 Q87K probably damaging Het
Itsn1 G A 16: 91,818,552 probably benign Het
Kif11 T C 19: 37,384,585 V84A probably damaging Het
Lemd2 A G 17: 27,201,677 M254T possibly damaging Het
Luc7l A T 17: 26,277,619 probably benign Het
Mapk11 T C 15: 89,146,743 E71G probably damaging Het
Mcoln2 G A 3: 146,150,011 probably null Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Pygb G T 2: 150,815,614 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sox6 A G 7: 115,580,563 probably null Het
Spty2d1 T C 7: 46,998,135 S349G probably damaging Het
Srbd1 A T 17: 86,051,150 V657D probably damaging Het
Tspo2 G T 17: 48,449,843 probably benign Het
Ufsp2 A G 8: 45,995,627 T422A possibly damaging Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Wdr46 A G 17: 33,940,744 T3A probably benign Het
Other mutations in Klf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02658:Klf2 APN 8 72319096 missense probably benign 0.23
R5538:Klf2 UTSW 8 72319472 missense probably damaging 1.00
R8137:Klf2 UTSW 8 72320244 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCGACAGGTGCATGCATG -3'
(R):5'- ACAGTATCCATTTCCCTTCTGGAG -3'

Sequencing Primer
(F):5'- TTGCACTACGGGCCTCC -3'
(R):5'- AGGATGGACAGGGTCTTCCTC -3'
Posted On2015-06-24