Incidental Mutation 'R4395:Soga3'
ID325448
Institutional Source Beutler Lab
Gene Symbol Soga3
Ensembl Gene ENSMUSG00000038916
Gene NameSOGA family member 3
Synonyms6330407J23Rik
MMRRC Submission 041684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R4395 (G1)
Quality Score135
Status Not validated
Chromosome10
Chromosomal Location29143839-29199630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29147355 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 233 (S233P)
Ref Sequence ENSEMBL: ENSMUSP00000090293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092629] [ENSMUST00000216757]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070359
SMART Domains Protein: ENSMUSP00000063425
Gene: ENSMUSG00000056316

DomainStartEndE-ValueType
low complexity region 65 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092629
AA Change: S233P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090293
Gene: ENSMUSG00000038916
AA Change: S233P

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 214 247 N/A INTRINSIC
SCOP:d1fxkc_ 354 488 2e-4 SMART
Blast:BRLZ 356 384 6e-10 BLAST
Pfam:DUF3166 519 613 1.8e-34 PFAM
Pfam:DUF3166 639 727 4.6e-34 PFAM
transmembrane domain 917 939 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000213243
AA Change: S7P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214863
Predicted Effect probably benign
Transcript: ENSMUST00000216757
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A G 4: 49,447,679 Y283H probably benign Het
Adamtsl5 A G 10: 80,344,902 C109R probably damaging Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Alpk3 C T 7: 81,094,955 S1266F probably damaging Het
Arfgef3 A G 10: 18,597,709 L1614P probably damaging Het
Atm T C 9: 53,465,227 R2038G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Capza2 T C 6: 17,656,450 probably null Het
Cfap43 T C 19: 47,751,913 T1274A probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cisd3 A G 11: 97,688,386 Y115C probably damaging Het
Crebl2 A G 6: 134,849,245 E53G probably damaging Het
Ech1 T C 7: 28,826,246 S107P probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Gm5724 T C 6: 141,712,118 I565V probably benign Het
Grm8 T A 6: 27,429,432 I488F probably damaging Het
Hmga2 C T 10: 120,476,051 G5S probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Ifit3b G T 19: 34,612,551 E376* probably null Het
Ints5 A G 19: 8,896,444 E589G probably damaging Het
Iqsec2 C T X: 152,209,053 T562I probably damaging Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Ltv1 T C 10: 13,190,579 Y101C probably benign Het
Maf1 T C 15: 76,352,157 probably benign Het
Map3k13 A T 16: 21,898,571 K185N possibly damaging Het
Mtus2 A T 5: 148,076,622 Q75L probably benign Het
Nod2 T A 8: 88,664,391 F427Y probably damaging Het
Olfr1496 A T 19: 13,780,911 I100F probably benign Het
Olfr470 A G 7: 107,845,262 L157P probably damaging Het
Pik3cg T C 12: 32,204,092 D632G probably damaging Het
Plekhs1 A G 19: 56,479,894 D298G probably benign Het
Rbm34 T C 8: 126,949,381 T375A probably benign Het
Slc4a7 C T 14: 14,765,665 T549I probably damaging Het
Stk17b A G 1: 53,764,115 I47T probably damaging Het
Tenm2 C T 11: 36,024,624 V2028I probably benign Het
Tle4 A T 19: 14,517,938 H142Q probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Trpm2 T C 10: 77,929,219 I983V probably benign Het
Ttll8 C T 15: 88,915,580 A553T possibly damaging Het
Ubxn11 G T 4: 134,116,120 E171D possibly damaging Het
Other mutations in Soga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Soga3 APN 10 29196473 nonsense probably null
IGL00929:Soga3 APN 10 29148292 missense probably damaging 0.99
IGL01450:Soga3 APN 10 29196323 missense probably damaging 1.00
IGL01462:Soga3 APN 10 29148258 missense probably damaging 1.00
IGL03062:Soga3 APN 10 29198949 missense probably damaging 1.00
R0534:Soga3 UTSW 10 29180956 splice site probably benign
R1355:Soga3 UTSW 10 29147322 missense probably benign 0.01
R1450:Soga3 UTSW 10 29147740 missense probably damaging 1.00
R1654:Soga3 UTSW 10 29146935 unclassified probably null
R1680:Soga3 UTSW 10 29196839 missense probably damaging 1.00
R2134:Soga3 UTSW 10 29196399 nonsense probably null
R2570:Soga3 UTSW 10 29146765 missense possibly damaging 0.88
R4859:Soga3 UTSW 10 29150394 missense probably benign 0.00
R4883:Soga3 UTSW 10 29196541 missense probably damaging 1.00
R4884:Soga3 UTSW 10 29196541 missense probably damaging 1.00
R5288:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5335:Soga3 UTSW 10 29147106 missense probably benign
R5384:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5385:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5457:Soga3 UTSW 10 29196724 missense probably benign 0.01
R5813:Soga3 UTSW 10 29150244 missense probably damaging 1.00
R5819:Soga3 UTSW 10 29197273 missense probably benign 0.00
R5950:Soga3 UTSW 10 29143648 unclassified probably benign
R6567:Soga3 UTSW 10 29147283 missense probably benign 0.00
R7312:Soga3 UTSW 10 29197244 missense probably damaging 1.00
R7313:Soga3 UTSW 10 29196879 nonsense probably null
R7445:Soga3 UTSW 10 29197003 missense possibly damaging 0.91
R7481:Soga3 UTSW 10 29196523 missense probably damaging 1.00
R7609:Soga3 UTSW 10 29148228 missense probably damaging 1.00
R7616:Soga3 UTSW 10 29146578 start gained probably benign
R7665:Soga3 UTSW 10 29196397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATAGAATCCGGGCCCTCG -3'
(R):5'- ACTACAAGGGGCTCACAGATG -3'

Sequencing Primer
(F):5'- AATCCGGGCCCTCGAAAGTC -3'
(R):5'- TCACAGATGGCTGGAGCG -3'
Posted On2015-07-06