Incidental Mutation 'R4364:Lcn10'
ID325657
Institutional Source Beutler Lab
Gene Symbol Lcn10
Ensembl Gene ENSMUSG00000047356
Gene Namelipocalin 10
Synonyms9230112J07Rik
MMRRC Submission 041672-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4364 (G1)
Quality Score147
Status Validated
Chromosome2
Chromosomal Location25682726-25686081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25684040 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 85 (C85F)
Ref Sequence ENSEMBL: ENSMUSP00000059353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058912] [ENSMUST00000059693] [ENSMUST00000114197] [ENSMUST00000114199]
Predicted Effect probably damaging
Transcript: ENSMUST00000058912
AA Change: C85F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059353
Gene: ENSMUSG00000047356
AA Change: C85F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Lipocalin 36 169 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059693
SMART Domains Protein: ENSMUSP00000055660
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114197
SMART Domains Protein: ENSMUSP00000109835
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 4.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114199
SMART Domains Protein: ENSMUSP00000109837
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lipocalin 33 172 2.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139441
Meta Mutation Damage Score 0.9122 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the lipocalin family, such as LCN10, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 T G 4: 59,082,294 T445P possibly damaging Het
Amn A C 12: 111,271,762 N37H probably damaging Het
Apoa5 A T 9: 46,270,529 D301V probably damaging Het
Atrn A G 2: 130,970,208 E691G probably benign Het
Ccer1 CGAGGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 10: 97,694,370 probably benign Het
Cct2 A G 10: 117,055,151 V396A probably damaging Het
Dhx35 C T 2: 158,842,352 Q516* probably null Het
Dopey2 A G 16: 93,770,924 K1413R probably benign Het
Dpp9 T C 17: 56,187,391 H856R possibly damaging Het
Eif4e2 T C 1: 87,224,371 F97L probably benign Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Exoc6b A T 6: 85,003,179 probably benign Het
Fat1 T A 8: 44,952,962 S917T probably benign Het
Frem1 A T 4: 82,913,251 Y2043N probably damaging Het
Galnt14 A G 17: 73,512,159 I312T probably damaging Het
Glipr1 T C 10: 111,985,637 N220S possibly damaging Het
Grid1 A G 14: 34,946,032 E172G probably benign Het
Hspa4l C A 3: 40,766,809 probably null Het
Il1rl2 G T 1: 40,351,791 R298L probably benign Het
Il7r T A 15: 9,512,928 H165L probably damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Olfr1293-ps G A 2: 111,527,640 V127M probably benign Het
Olfr1425 A G 19: 12,074,497 V45A probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Prkce C T 17: 86,476,851 T218I probably damaging Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sptbn5 A G 2: 120,068,655 L428P probably damaging Het
Syne1 A G 10: 5,353,987 V789A probably damaging Het
Taar8c C T 10: 24,101,579 V112M probably benign Het
Tex10 T C 4: 48,468,774 I51V probably benign Het
Ttll1 T A 15: 83,499,994 Q144L probably damaging Het
Other mutations in Lcn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Lcn10 APN 2 25684020 unclassified probably benign
R0030:Lcn10 UTSW 2 25685081 missense probably damaging 1.00
R1832:Lcn10 UTSW 2 25685139 missense probably damaging 1.00
R1931:Lcn10 UTSW 2 25684335 missense probably damaging 1.00
R2890:Lcn10 UTSW 2 25683630 missense probably damaging 1.00
R5511:Lcn10 UTSW 2 25682829 missense probably benign 0.00
R6219:Lcn10 UTSW 2 25683575 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAATCTCTCAGCTCTGGGC -3'
(R):5'- ATAGAGCCCTCACTGACCTC -3'

Sequencing Primer
(F):5'- GCCTTTGCCCAAATGAGAAGATTC -3'
(R):5'- TCACTTCCCAGGCCAGGTC -3'
Posted On2015-07-06