Incidental Mutation 'R4414:1110017D15Rik'
List |< first << previous [record 30 of 86095] next >> last >|
ID328055
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene NameRIKEN cDNA 1110017D15 gene
SynonymsSmrp1, Cbe1
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41505009-41517333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41505574 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000092744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000054920] [ENSMUST00000095126] [ENSMUST00000149596]
Predicted Effect silent
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054920
SMART Domains Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
Pfam:Glyco_hydro_31 311 712 9.7e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095126
AA Change: T183A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441
AA Change: T183A

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124019
Predicted Effect unknown
Transcript: ENSMUST00000125303
AA Change: N179S
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441
AA Change: N179S

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138217
Predicted Effect probably benign
Transcript: ENSMUST00000149596
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41507538 missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41507519 critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41517200 unclassified probably benign
R5132:1110017D15Rik UTSW 4 41517178 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41505135 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCAACCATTGACGTCCCATG -3'
(R):5'- TTCCCAGAGATTGTGCTGTAG -3'

Sequencing Primer
(F):5'- ATTGACGTCCCATGGCGCTAG -3'
(R):5'- CCTTAAGACTGATTCTGTATCCAGG -3'
Posted On2015-07-07