Incidental Mutation 'R0047:Cacna1d'
ID 32995
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Name calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms C79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
MMRRC Submission 038341-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.836) question?
Stock # R0047 (G1)
Quality Score 177
Status Validated (trace)
Chromosome 14
Chromosomal Location 30039939-30491455 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to G at 30346790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
AlphaFold Q99246
Predicted Effect probably benign
Transcript: ENSMUST00000112249
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968

low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112250
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968

low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223985
Predicted Effect probably benign
Transcript: ENSMUST00000224198
Predicted Effect probably benign
Transcript: ENSMUST00000224395
Predicted Effect probably benign
Transcript: ENSMUST00000224785
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (98/98)
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,264 T405A probably damaging Het
4932438A13Rik T A 3: 36,908,192 L481M possibly damaging Het
Acer1 A T 17: 56,955,624 D175E possibly damaging Het
Acsf2 T C 11: 94,569,342 I395V probably benign Het
Adamts9 G A 6: 92,905,306 probably benign Het
Amigo3 T C 9: 108,054,658 S427P probably benign Het
Ankrd35 A G 3: 96,684,063 K555R probably benign Het
Arhgap35 A T 7: 16,561,992 H1049Q probably benign Het
Arhgef5 G A 6: 43,265,621 probably null Het
Arid4a T G 12: 71,075,419 L858W probably damaging Het
Bbox1 A G 2: 110,268,302 F310S probably damaging Het
Bhlhe22 T C 3: 18,055,569 L261P probably damaging Het
Bmper T A 9: 23,406,686 C534S probably damaging Het
Camk2g G A 14: 20,771,068 probably benign Het
Capn12 G A 7: 28,890,387 probably null Het
Cdkl4 T G 17: 80,550,845 N115T probably benign Het
Chchd1 T C 14: 20,704,163 S48P possibly damaging Het
Chia1 G T 3: 106,115,257 C49F probably damaging Het
Cnot7 A G 8: 40,495,921 probably benign Het
Crh T C 3: 19,694,037 E147G probably damaging Het
Cux1 T C 5: 136,363,253 probably benign Het
Cyp2b19 T A 7: 26,766,826 D351E probably benign Het
Dctn1 G T 6: 83,182,632 G31* probably null Het
Duox1 T A 2: 122,346,641 probably benign Het
Egflam T G 15: 7,253,430 E382A possibly damaging Het
Ext1 T C 15: 53,345,146 N73S probably benign Het
Ffar4 A G 19: 38,114,004 probably benign Het
Glg1 A T 8: 111,165,582 M866K probably damaging Het
Golm1 T A 13: 59,645,100 H197L probably benign Het
Gtse1 A G 15: 85,862,378 K132E probably damaging Het
Gxylt2 A T 6: 100,733,378 probably benign Het
Hrc T A 7: 45,336,689 S421R probably benign Het
Ighg2c T A 12: 113,288,168 probably benign Het
Ihh A G 1: 74,946,591 I245T probably benign Het
Ilf3 T A 9: 21,388,714 M65K possibly damaging Het
Insr A G 8: 3,202,947 V404A probably damaging Het
Irak2 G T 6: 113,672,953 probably benign Het
Irak2 G A 6: 113,678,738 V367I probably benign Het
Kat7 A C 11: 95,300,208 N119K probably benign Het
Kif9 A G 9: 110,485,038 I33V probably benign Het
Klf17 A G 4: 117,761,032 Y43H probably benign Het
Kng2 T A 16: 22,987,563 T629S possibly damaging Het
Lama1 A T 17: 67,795,186 probably benign Het
Lamb1 T C 12: 31,278,601 I188T possibly damaging Het
Lpp T A 16: 24,661,800 probably benign Het
Lrp12 T C 15: 39,878,239 E360G probably damaging Het
Mark2 A C 19: 7,283,577 probably benign Het
Mmp3 T C 9: 7,451,910 probably benign Het
Mthfd1l T A 10: 3,978,727 probably benign Het
Mtr A T 13: 12,222,226 S569T probably damaging Het
Myh13 T A 11: 67,367,237 S1752T probably benign Het
Myo5a T A 9: 75,156,207 L565H probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nfkb1 A T 3: 135,595,053 L72* probably null Het
Numa1 A G 7: 102,009,453 K296E probably damaging Het
Olfr1477 A G 19: 13,502,589 E82G probably benign Het
Olfr186 T A 16: 59,027,224 M228L probably benign Het
Olfr201 C T 16: 59,269,211 G152D probably damaging Het
Olfr508 A G 7: 108,630,552 I187V probably benign Het
Olfr613 A T 7: 103,552,322 Y179F probably damaging Het
Pcdhb5 A T 18: 37,321,268 I234F possibly damaging Het
Pgm5 T A 19: 24,684,556 I545F probably damaging Het
Pla2g2c T C 4: 138,743,590 probably benign Het
Pnpla7 A T 2: 25,011,606 E548V probably damaging Het
Ppm1m C A 9: 106,196,696 E273* probably null Het
Ppp2r1b C T 9: 50,861,573 R117* probably null Het
Rabgap1l G A 1: 160,231,789 probably benign Het
Rapgef6 T A 11: 54,546,378 M49K possibly damaging Het
Rhox4f A C X: 37,607,469 V15G probably benign Het
Rnf219 T A 14: 104,503,344 probably null Het
Rtel1 T G 2: 181,323,405 I146M probably damaging Het
Sdr9c7 A T 10: 127,903,672 M219L probably benign Het
Serpina3g T A 12: 104,240,284 S115T possibly damaging Het
Serpinb1a A T 13: 32,850,276 L44Q probably damaging Het
Slc13a4 A G 6: 35,287,362 I190T possibly damaging Het
Slc46a2 A G 4: 59,914,392 L177P probably damaging Het
Slc47a2 C T 11: 61,336,242 V167M possibly damaging Het
Snrnp200 C T 2: 127,234,954 probably benign Het
Snx13 C A 12: 35,101,124 probably benign Het
Snx25 C T 8: 46,041,365 A828T probably damaging Het
Spic A G 10: 88,675,941 L151P probably damaging Het
Ssu2 G A 6: 112,374,820 H315Y probably damaging Het
Stk32a T C 18: 43,313,378 probably benign Het
Tbx3 A T 5: 119,680,446 E382V probably damaging Het
Tcaf2 A G 6: 42,629,613 I469T probably benign Het
Tln2 A G 9: 67,240,672 probably benign Het
Top2a T A 11: 98,997,856 I1260L probably benign Het
Treml1 C A 17: 48,364,980 S91* probably null Het
Trim26 T C 17: 36,857,864 probably benign Het
Trmt11 T C 10: 30,535,243 N418S probably benign Het
Ttf1 A G 2: 29,084,655 Y801C probably damaging Het
Usp34 C T 11: 23,464,403 A2782V probably benign Het
Vmn2r77 T C 7: 86,811,650 V728A probably benign Het
Vps4a T C 8: 107,036,701 L29P probably damaging Het
Wdfy3 A G 5: 101,944,033 I480T probably damaging Het
Wdr41 A G 13: 95,010,287 I197V probably damaging Het
Ywhag A T 5: 135,911,299 V147E probably damaging Het
Zan A G 5: 137,403,656 M4058T unknown Het
Zfp236 C T 18: 82,680,692 C88Y probably damaging Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
Brisk UTSW 14 30171314 missense possibly damaging 0.91
Troppo UTSW 14 30123454 missense probably damaging 1.00
PIT4651001:Cacna1d UTSW 14 30178645 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
R7188:Cacna1d UTSW 14 30089833 missense probably benign
R7242:Cacna1d UTSW 14 30178706 missense probably benign 0.00
R7249:Cacna1d UTSW 14 30142703 missense probably damaging 1.00
R7250:Cacna1d UTSW 14 30075151 missense probably damaging 1.00
R7274:Cacna1d UTSW 14 30142643 missense probably damaging 1.00
R7336:Cacna1d UTSW 14 30045282 missense probably benign 0.18
R7343:Cacna1d UTSW 14 30123057 missense probably benign 0.02
R7411:Cacna1d UTSW 14 30352990 start codon destroyed probably null
R7461:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7534:Cacna1d UTSW 14 30079362 missense probably damaging 1.00
R7613:Cacna1d UTSW 14 30066163 missense probably benign 0.05
R7661:Cacna1d UTSW 14 30047220 missense probably benign 0.07
R7754:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R7759:Cacna1d UTSW 14 30099188 missense probably benign 0.01
R7784:Cacna1d UTSW 14 30123439 missense probably damaging 1.00
R7808:Cacna1d UTSW 14 30111069 missense probably damaging 1.00
R7965:Cacna1d UTSW 14 30047313 nonsense probably null
R8225:Cacna1d UTSW 14 30123033 missense probably benign 0.23
R8259:Cacna1d UTSW 14 30051518 missense probably benign
R8348:Cacna1d UTSW 14 30102407 missense probably damaging 1.00
R8448:Cacna1d UTSW 14 30102407 missense probably damaging 1.00
R8822:Cacna1d UTSW 14 30178735 missense probably benign 0.02
R8848:Cacna1d UTSW 14 30123326 missense possibly damaging 0.89
R9122:Cacna1d UTSW 14 30123445 missense probably damaging 1.00
R9122:Cacna1d UTSW 14 30130168 missense probably benign 0.00
R9169:Cacna1d UTSW 14 30074916 missense probably damaging 1.00
R9199:Cacna1d UTSW 14 30042936 missense probably benign 0.26
R9203:Cacna1d UTSW 14 30051712 missense probably benign 0.04
R9263:Cacna1d UTSW 14 30074968 missense probably damaging 1.00
R9346:Cacna1d UTSW 14 30096923 missense possibly damaging 0.86
Z1176:Cacna1d UTSW 14 30111116 missense probably benign 0.15
Z1176:Cacna1d UTSW 14 30179188 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ccagaaagattaaccacagtatcc -3'
Posted On 2013-05-09