Mutagenetix > Incidental Mutation

Incidental Mutation 'R8079:Ifi206'

629174

Institutional Source

Beutler Lab

Gene Symbol

Ifi206

Ensembl Gene

ENSMUSG00000037849

Gene Name

interferon activated gene 206

Synonyms

Gm4955, Pyblhin-C

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R8079 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

173468485-173491041 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 173481158 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 424 (P424L)

Ref Sequence

ENSEMBL: ENSMUSP00000134646 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160565]

AlphaFold

G3UZV2

Predicted Effect

SMART Domains

Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849
AA Change: P424L

Domain	Start	End	E-Value	Type
PYRIN	6	84	5.7e-21	SMART
low complexity region	97	108	N/A	INTRINSIC
internal_repeat_1	154	349	6.25e-15	PROSPERO
internal_repeat_1	342	575	6.25e-15	PROSPERO

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 96.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	A	G	5: 124,083,123	I255T	possibly damaging	Het
Ablim1	A	T	19: 57,182,224		probably null	Het
Akap10	G	A	11: 61,930,054	P8L	possibly damaging	Het
Ankle2	C	T	5: 110,231,316	A27V	probably damaging	Het
Anxa8	A	G	14: 34,094,812	T246A	probably benign	Het
Arhgap5	A	G	12: 52,567,205	N1460S	probably benign	Het
Arid5b	T	G	10: 68,098,356	D572A	possibly damaging	Het
Atrn	T	A	2: 131,013,641	L1278Q	probably null	Het
AU040320	G	T	4: 126,832,160	K454N	possibly damaging	Het
Baz2b	T	A	2: 59,900,768	R2085W	probably damaging	Het
Bbx	A	T	16: 50,210,458	N649K	probably damaging	Het
BC034090	G	A	1: 155,225,286	P411S	probably damaging	Het
Calcoco2	A	T	11: 96,107,537	F20Y	probably damaging	Het
Carmil2	A	G	8: 105,686,761	R50G	probably damaging	Het
Catspere2	A	G	1: 178,046,959	T131A	probably benign	Het
Cdcp1	C	A	9: 123,173,790	V739L	probably damaging	Het
Chit1	A	G	1: 134,144,027	T92A	possibly damaging	Het
Clstn3	A	G	6: 124,459,804	I185T	probably damaging	Het
Dctpp1	C	A	7: 127,259,389	V61L	probably damaging	Het
Dip2a	T	C	10: 76,287,321	T760A	probably benign	Het
Dock10	C	T	1: 80,578,704	V552I	probably benign	Het
Dpcr1	T	C	17: 35,638,192	T172A	unknown	Het
Dpp8	A	G	9: 65,043,735	E151G	probably damaging	Het
Dvl2	G	C	11: 70,007,518	R367P	possibly damaging	Het
Fem1b	A	T	9: 62,796,361	I539N	probably damaging	Het
Frat2	A	T	19: 41,847,838	L25H	probably damaging	Het
Garnl3	A	T	2: 33,018,499		probably null	Het
Gh	T	C	11: 106,301,427	H47R	possibly damaging	Het
Glmp	T	C	3: 88,325,738	V61A	probably damaging	Het
Gm6614	T	G	6: 141,987,734	M462L	probably benign	Het
Gm9925	T	C	18: 74,065,487	V129A	unknown	Het
H2-M9	T	A	17: 36,642,133	E94V	probably benign	Het
Hira	A	T	16: 18,925,757	Q408L	probably benign	Het
Hook3	A	G	8: 26,088,058		probably null	Het
Impdh2	T	C	9: 108,563,325	V270A	probably benign	Het
Klhl14	A	G	18: 21,651,965	I135T	probably benign	Het
Klra10	C	A	6: 130,275,775	V179L	probably benign	Het
Kmt2c	T	C	5: 25,302,732	S3236G	probably damaging	Het
Krt76	G	T	15: 101,888,390	A358D	possibly damaging	Het
Lacc1	C	A	14: 77,029,552	G424C	probably damaging	Het
Limch1	A	G	5: 67,046,753	I878V	possibly damaging	Het
Lipi	C	T	16: 75,565,530		probably null	Het
Lrrc17	C	T	5: 21,561,071	R184W	probably damaging	Het
Mllt10	A	G	2: 18,123,756	N183D	probably damaging	Het
Mterf2	C	T	10: 85,120,163	G199D	probably damaging	Het
Nat8f4	A	T	6: 85,900,994	S182R	probably benign	Het
Ndrg3	C	A	2: 156,937,532	E238*	probably null	Het
Nop14	A	T	5: 34,654,461	L194H	probably damaging	Het
Obscn	T	C	11: 59,081,905	E2105G	possibly damaging	Het
Olfr1009	A	T	2: 85,722,043	T213S	probably benign	Het
Olfr1079	T	A	2: 86,538,381	H176L	possibly damaging	Het
Olfr1457	A	C	19: 13,095,284	Y121*	probably null	Het
Olfr829	A	T	9: 18,857,429	Y259F	possibly damaging	Het
Pbx3	C	T	2: 34,178,228	A320T	probably benign	Het
Pcdhac2	A	T	18: 37,146,144	S726C	probably damaging	Het
Pcdhgb2	A	G	18: 37,690,763	D269G	probably damaging	Het
Pcgf6	A	T	19: 47,045,832	S257T	probably damaging	Het
Pclo	A	T	5: 14,540,458	H924L	unknown	Het
Per3	T	A	4: 151,042,678	T129S	possibly damaging	Het
Pi4ka	A	T	16: 17,303,060	M1270K		Het
Plec	G	A	15: 76,179,550	Q2277*	probably null	Het
Pnma1	T	A	12: 84,147,335	K198M	probably damaging	Het
Prc1	T	A	7: 80,304,767	F196L	possibly damaging	Het
Prkcz	T	C	4: 155,357,505	T57A	probably damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Robo4	A	G	9: 37,402,635	M61V	possibly damaging	Het
Rps12	C	T	10: 23,785,677	V79I	probably benign	Het
Rsph3a	A	G	17: 7,979,188	K466E	probably benign	Het
Scly	A	T	1: 91,308,367	I168F	probably damaging	Het
Setd1a	T	A	7: 127,785,053	F359I	unknown	Het
Sh3tc1	A	G	5: 35,706,857	L662P	possibly damaging	Het
Slc12a5	T	C	2: 164,992,452	W798R	probably damaging	Het
Slc16a6	C	T	11: 109,473,455	R13Q	unknown	Het
Smarcad1	A	G	6: 65,052,782	D118G	possibly damaging	Het
Sos2	T	C	12: 69,607,215	T788A	probably damaging	Het
Syvn1	A	G	19: 6,048,366	E75G	probably null	Het
Thpo	T	C	16: 20,726,394	E103G	probably benign	Het
Trav7d-3	A	T	14: 52,744,736	E78V	possibly damaging	Het
Uap1	A	G	1: 170,158,763	S217P	probably damaging	Het
Unc45a	T	G	7: 80,331,562	R497S	probably damaging	Het
Upf1	A	G	8: 70,338,884		probably null	Het
Usp47	A	T	7: 112,046,970	K28M	probably damaging	Het
Wdr72	A	C	9: 74,218,772	T1062P	probably damaging	Het
Wnt7b	A	T	15: 85,537,445	C339S	probably damaging	Het
Zfp954	G	T	7: 7,115,471	T358K	probably benign	Het
Zmynd15	G	T	11: 70,459,452		probably benign	Het

Other mutations in Ifi206

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01509:Ifi206	APN	1	173485576	missense	probably benign	0.00
IGL02044:Ifi206	APN	1	173480991	missense	probably benign	0.41
IGL02118:Ifi206	APN	1	173481768	missense	probably benign	0.05
IGL02476:Ifi206	APN	1	173481566	missense	probably benign	0.02
IGL02824:Ifi206	APN	1	173481872	missense	possibly damaging	0.95
IGL03375:Ifi206	APN	1	173480778	missense	probably benign	0.06
PIT4142001:Ifi206	UTSW	1	173481164	missense	probably benign	0.02
R0069:Ifi206	UTSW	1	173486847	missense	probably damaging	1.00
R0741:Ifi206	UTSW	1	173473749	missense	probably benign	0.41
R1572:Ifi206	UTSW	1	173486853	missense	probably benign	0.10
R1742:Ifi206	UTSW	1	173481971	missense	probably benign	0.06
R4109:Ifi206	UTSW	1	173480988	missense	probably benign	0.00
R4707:Ifi206	UTSW	1	173480866	missense	probably benign	0.00
R4783:Ifi206	UTSW	1	173480866	missense	probably benign	0.00
R4785:Ifi206	UTSW	1	173480866	missense	probably benign	0.00
R4805:Ifi206	UTSW	1	173481386	missense	possibly damaging	0.55
R4918:Ifi206	UTSW	1	173482044	missense	possibly damaging	0.73
R5043:Ifi206	UTSW	1	173486718	missense	probably damaging	1.00
R5080:Ifi206	UTSW	1	173473848	missense	possibly damaging	0.61
R5419:Ifi206	UTSW	1	173481231	missense	probably benign	0.05
R5420:Ifi206	UTSW	1	173481033	missense	possibly damaging	0.84
R5777:Ifi206	UTSW	1	173481362	missense	possibly damaging	0.55
R5988:Ifi206	UTSW	1	173481340	missense	possibly damaging	0.90
R6772:Ifi206	UTSW	1	173481207	missense	unknown
R6782:Ifi206	UTSW	1	173481357	missense	unknown
R6806:Ifi206	UTSW	1	173481571	missense	probably benign	0.06
R7042:Ifi206	UTSW	1	173481242	missense
R7091:Ifi206	UTSW	1	173473875	missense	unknown
R7292:Ifi206	UTSW	1	173473862	missense	unknown
R7429:Ifi206	UTSW	1	173480591	missense
R7499:Ifi206	UTSW	1	173482041	missense
R7772:Ifi206	UTSW	1	173481074	missense
R7853:Ifi206	UTSW	1	173471534	nonsense	probably null
R7971:Ifi206	UTSW	1	173471410	missense	unknown
R8205:Ifi206	UTSW	1	173481884	missense
R8289:Ifi206	UTSW	1	173480466	missense
R8390:Ifi206	UTSW	1	173480945	missense
R8500:Ifi206	UTSW	1	173486745	missense
R8712:Ifi206	UTSW	1	173480508	missense
R8753:Ifi206	UTSW	1	173473657	missense	unknown
R8875:Ifi206	UTSW	1	173473787	missense	unknown
R9128:Ifi206	UTSW	1	173471456	missense	unknown
R9369:Ifi206	UTSW	1	173473923	missense	unknown
R9569:Ifi206	UTSW	1	173486643	missense
R9676:Ifi206	UTSW	1	173481152	missense
R9695:Ifi206	UTSW	1	173473683	missense	unknown
R9776:Ifi206	UTSW	1	173480509	missense
X0052:Ifi206	UTSW	1	173481969	missense	possibly damaging	0.89
Z1088:Ifi206	UTSW	1	173474011	missense	probably damaging	1.00
Z1176:Ifi206	UTSW	1	173482048	missense

Predicted Primers

PCR Primer
(F):5'- GGTCAGTTGAAAGCTCTGGC -3'
(R):5'- AATAGTCCTCATGTTTCTGCAGC -3'

Sequencing Primer
(F):5'- AGTTGAAAGCTCTGGCCACTG -3'
(R):5'- TGTTTCTGCAGCAACAATATCCAGC -3'

Posted On

2020-06-30