Incidental Mutation 'R4514:Mdga2'
ID332814
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 041588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4514 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66716722 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 200 (I200T)
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: I269T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: I269T

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177690
Predicted Effect unknown
Transcript: ENSMUST00000178814
AA Change: I259T
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: I259T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: I200T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: I200T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 24,818,136 T51P probably damaging Het
Akr1c20 A C 13: 4,507,844 V201G probably damaging Het
Alg9 C T 9: 50,805,354 T409M possibly damaging Het
Arpp21 T A 9: 112,177,677 T155S probably damaging Het
Atm T A 9: 53,493,039 Q1334L probably damaging Het
Bptf G A 11: 107,077,692 T1055M probably damaging Het
Cd3g C A 9: 44,973,584 A121S possibly damaging Het
Cenpn A G 8: 116,933,396 Y68C probably damaging Het
Clock A G 5: 76,230,199 I618T probably benign Het
Cp A G 3: 19,988,013 M982V probably damaging Het
Csf3r T A 4: 126,039,860 S611T possibly damaging Het
Csn3 A G 5: 87,930,138 T168A unknown Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
D630003M21Rik T C 2: 158,204,802 T752A probably benign Het
Defb34 A T 8: 19,126,506 D71V probably damaging Het
Dync1h1 T A 12: 110,657,139 D3615E possibly damaging Het
Etl4 A T 2: 20,661,898 T167S probably damaging Het
F5 T A 1: 164,151,997 probably benign Het
Got1l1 C T 8: 27,198,485 M279I probably benign Het
Grm7 A G 6: 111,358,304 T559A possibly damaging Het
Ifit1 A T 19: 34,648,513 R350* probably null Het
Ighv2-5 T C 12: 113,685,596 N79S possibly damaging Het
Igkv17-127 A G 6: 67,861,514 I70V possibly damaging Het
Itga8 T C 2: 12,182,736 S711G probably benign Het
Kndc1 A G 7: 139,910,286 T235A probably benign Het
Lct T C 1: 128,300,514 I1081V probably benign Het
Lrrc8b G T 5: 105,479,953 C55F probably damaging Het
Lrwd1 T C 5: 136,131,548 T311A probably benign Het
Mapk14 T C 17: 28,724,824 F129S probably damaging Het
Mocos T A 18: 24,683,212 S615R probably damaging Het
Myh4 T C 11: 67,255,569 V1456A probably benign Het
Myh9 T C 15: 77,764,000 I1759V probably benign Het
Nat8f5 G A 6: 85,817,423 T185I possibly damaging Het
Nav3 T C 10: 109,694,082 I2133V possibly damaging Het
Ncam2 T A 16: 81,512,996 M458K probably benign Het
Nphp1 T C 2: 127,748,087 S532G probably benign Het
Olfr1184 T C 2: 88,487,365 V211A probably benign Het
Olfr649 C T 7: 104,189,391 R272H probably benign Het
Oplah A G 15: 76,297,955 L1035P probably damaging Het
Pask T A 1: 93,322,133 Q515L probably benign Het
Poglut1 A T 16: 38,549,416 F35I probably benign Het
Ppp1ca T G 19: 4,195,055 I319S probably benign Het
Psg25 T A 7: 18,529,608 R97* probably null Het
Sars2 T C 7: 28,742,284 probably null Het
Slc15a4 A G 5: 127,604,536 probably null Het
Slc16a7 T G 10: 125,233,439 probably null Het
Slc7a8 C G 14: 54,735,790 G240A possibly damaging Het
St6gal2 A T 17: 55,483,017 N351Y probably benign Het
Susd5 T C 9: 114,095,924 F292L probably benign Het
Tmco5 T A 2: 116,880,314 D38E probably damaging Het
Tubgcp2 G A 7: 139,996,071 P893L possibly damaging Het
Uncx A G 5: 139,546,767 I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 C138Y probably damaging Het
Zfp609 A G 9: 65,703,695 I662T possibly damaging Het
Zfp985 G A 4: 147,583,563 C296Y probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTATCAACTGGCCTATAAGAAG -3'
(R):5'- CCCCTAGGAAGCAAGTTTGC -3'

Sequencing Primer
(F):5'- AACGACACCATCTTGTCT -3'
(R):5'- AGTTTTTACCTCTAAGCATATTCCAG -3'
Posted On2015-08-18