Incidental Mutation 'R4535:Slc38a3'
ID333293
Institutional Source Beutler Lab
Gene Symbol Slc38a3
Ensembl Gene ENSMUSG00000010064
Gene Namesolute carrier family 38, member 3
SynonymsSnat3, 0610012J02Rik, D9Ucla2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107650634-107669530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107656206 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 251 (N251S)
Ref Sequence ENSEMBL: ENSMUSP00000142087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010208] [ENSMUST00000167868] [ENSMUST00000177567] [ENSMUST00000192323] [ENSMUST00000192990] [ENSMUST00000193932] [ENSMUST00000195843]
Predicted Effect probably benign
Transcript: ENSMUST00000010208
AA Change: N251S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000010208
Gene: ENSMUSG00000010064
AA Change: N251S

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167868
AA Change: N251S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130414
Gene: ENSMUSG00000010064
AA Change: N251S

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177567
AA Change: N251S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137561
Gene: ENSMUSG00000010064
AA Change: N251S

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 5.5e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191923
Predicted Effect unknown
Transcript: ENSMUST00000192211
AA Change: N8S
Predicted Effect probably benign
Transcript: ENSMUST00000192323
SMART Domains Protein: ENSMUSP00000141850
Gene: ENSMUSG00000010064

DomainStartEndE-ValueType
Pfam:Aa_trans 63 181 2.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192990
SMART Domains Protein: ENSMUSP00000141528
Gene: ENSMUSG00000010064

DomainStartEndE-ValueType
Pfam:Aa_trans 63 154 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193495
Predicted Effect probably benign
Transcript: ENSMUST00000193932
AA Change: N251S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142087
Gene: ENSMUSG00000010064
AA Change: N251S

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194895
Predicted Effect unknown
Transcript: ENSMUST00000195739
AA Change: N57S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195033
Predicted Effect probably benign
Transcript: ENSMUST00000195843
SMART Domains Protein: ENSMUSP00000141552
Gene: ENSMUSG00000010064

DomainStartEndE-ValueType
Pfam:Aa_trans 63 99 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU allele exhibit complete postnatal lethality between P18 and P20, altered amino acid levels in the serum, liver and brain, and decreased ammonia excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Slc38a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Slc38a3 APN 9 107658677 missense probably damaging 1.00
PIT4354001:Slc38a3 UTSW 9 107657649 missense probably benign 0.01
R0522:Slc38a3 UTSW 9 107655213 unclassified probably null
R0865:Slc38a3 UTSW 9 107655648 missense probably damaging 1.00
R0919:Slc38a3 UTSW 9 107655959 missense probably damaging 1.00
R1265:Slc38a3 UTSW 9 107651986 missense probably damaging 1.00
R1864:Slc38a3 UTSW 9 107655953 missense probably damaging 1.00
R2919:Slc38a3 UTSW 9 107657687 missense probably damaging 1.00
R4209:Slc38a3 UTSW 9 107655348 missense possibly damaging 0.78
R4343:Slc38a3 UTSW 9 107656472 missense possibly damaging 0.52
R4534:Slc38a3 UTSW 9 107656206 missense probably benign 0.00
R4860:Slc38a3 UTSW 9 107655064 missense probably damaging 1.00
R4860:Slc38a3 UTSW 9 107655064 missense probably damaging 1.00
R4916:Slc38a3 UTSW 9 107656227 missense probably benign
R5058:Slc38a3 UTSW 9 107659191 missense possibly damaging 0.53
R5219:Slc38a3 UTSW 9 107651912 unclassified probably benign
R5776:Slc38a3 UTSW 9 107658749 nonsense probably null
R6029:Slc38a3 UTSW 9 107652175 missense probably damaging 1.00
R6146:Slc38a3 UTSW 9 107655029 missense probably benign
R6292:Slc38a3 UTSW 9 107655154 missense possibly damaging 0.88
R7250:Slc38a3 UTSW 9 107656666 missense probably benign 0.31
R8221:Slc38a3 UTSW 9 107657709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAAAGGACTATGTCAAGGC -3'
(R):5'- TCAGAAAAGAGCAGTGGCCC -3'

Sequencing Primer
(F):5'- AGGACTATGTCAAGGCAGCCC -3'
(R):5'- CGAGGGAGTCCTGTGTCAGAG -3'
Posted On2015-08-18