Incidental Mutation 'R4535:Cd200r3'
ID333304
Institutional Source Beutler Lab
Gene Symbol Cd200r3
Ensembl Gene ENSMUSG00000036172
Gene NameCD200 receptor 3
Synonyms4833409J19Rik, mCD200RLb, 4733401I18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4535 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44943678-44981380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44954189 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 188 (D188E)
Ref Sequence ENSEMBL: ENSMUSP00000128974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048479] [ENSMUST00000077178] [ENSMUST00000114611] [ENSMUST00000114612] [ENSMUST00000114613] [ENSMUST00000114622] [ENSMUST00000164007] [ENSMUST00000166731] [ENSMUST00000171779]
Predicted Effect probably benign
Transcript: ENSMUST00000048479
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036624
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 270 8e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000077178
SMART Domains Protein: ENSMUSP00000076421
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 1e-12 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114611
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110258
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114612
SMART Domains Protein: ENSMUSP00000110259
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 163 8e-13 PDB
Blast:IG 65 163 2e-22 BLAST
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114613
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110260
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 9e-43 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 274 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114622
SMART Domains Protein: ENSMUSP00000110269
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.9e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164007
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130480
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 1e-42 PDB
Blast:IG 65 163 1e-21 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166731
AA Change: D188E

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128974
Gene: ENSMUSG00000036172
AA Change: D188E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 49 N/A INTRINSIC
PDB:4BFI|A 58 238 8e-43 PDB
Blast:IG 65 163 9e-22 BLAST
Blast:IG_like 165 273 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171779
SMART Domains Protein: ENSMUSP00000132938
Gene: ENSMUSG00000036172

DomainStartEndE-ValueType
Pfam:V-set 22 164 6.7e-6 PFAM
transmembrane domain 171 193 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 T C 1: 34,723,081 S473P unknown Het
Azin1 A T 15: 38,493,605 I258N probably benign Het
Bod1l G A 5: 41,832,231 A383V probably benign Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cd4 A T 6: 124,870,451 F250Y probably benign Het
Clcn4 T A 7: 7,287,814 Y662F probably benign Het
Cpa2 T C 6: 30,552,021 V249A probably benign Het
Depdc5 CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT CTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCT 5: 32,910,407 probably benign Het
Dhx57 A G 17: 80,275,082 Y365H probably damaging Het
Dsg1c A G 18: 20,275,265 E457G probably benign Het
Eef2k T A 7: 120,858,599 Y60* probably null Het
Efcc1 A G 6: 87,753,151 D482G probably null Het
Exoc4 C T 6: 33,277,244 R112C probably damaging Het
Fam178b A T 1: 36,600,525 D293E probably benign Het
Fbxl21 G A 13: 56,527,060 V49I probably damaging Het
Fyco1 A G 9: 123,838,888 V91A probably damaging Het
H2-M10.4 T C 17: 36,461,844 E82G probably damaging Het
Hmcn1 A G 1: 150,563,780 I5434T probably damaging Het
Hormad1 T C 3: 95,585,141 V343A probably benign Het
Incenp T C 19: 9,883,939 N450S unknown Het
Iqsec3 T C 6: 121,380,018 K1035E possibly damaging Het
Ltn1 A T 16: 87,426,286 V102D probably damaging Het
Mcur1 T C 13: 43,544,540 T295A probably damaging Het
Mpp5 A T 12: 78,824,837 D397V possibly damaging Het
Pcdha3 T C 18: 36,947,960 V585A probably damaging Het
Plcd4 A G 1: 74,563,468 T594A probably damaging Het
Ppp1r3c T C 19: 36,734,122 K83E probably damaging Het
Sesn3 C A 9: 14,322,658 T309K probably benign Het
Slc38a3 T C 9: 107,656,206 N251S probably benign Het
Sptbn4 A G 7: 27,367,702 V614A probably damaging Het
Srsf4 A G 4: 131,873,864 K34R probably damaging Het
Tfpi2 T C 6: 3,968,044 N32S possibly damaging Het
Ttll2 A T 17: 7,351,721 I269N probably benign Het
Utp3 T C 5: 88,555,599 V329A probably benign Het
Vmn2r102 A G 17: 19,694,713 T847A probably benign Het
Vmn2r70 A T 7: 85,565,333 W204R probably damaging Het
Xrcc3 A G 12: 111,804,532 L321P probably damaging Het
Other mutations in Cd200r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02996:Cd200r3 APN 16 44954317 missense probably damaging 1.00
IGL03003:Cd200r3 APN 16 44943775 start codon destroyed probably null 0.90
IGL03003:Cd200r3 APN 16 44943776 missense probably benign 0.01
IGL03005:Cd200r3 APN 16 44953610 missense probably damaging 1.00
IGL03354:Cd200r3 APN 16 44953597 missense possibly damaging 0.64
R0620:Cd200r3 UTSW 16 44957717 splice site probably null
R1451:Cd200r3 UTSW 16 44951547 missense possibly damaging 0.76
R1623:Cd200r3 UTSW 16 44951448 missense possibly damaging 0.71
R2980:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R2982:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R3758:Cd200r3 UTSW 16 44964628 splice site probably null
R4167:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4168:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4175:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4534:Cd200r3 UTSW 16 44954189 missense probably benign 0.25
R4801:Cd200r3 UTSW 16 44957825 missense possibly damaging 0.82
R4802:Cd200r3 UTSW 16 44957825 missense possibly damaging 0.82
R4937:Cd200r3 UTSW 16 44954259 missense probably benign 0.01
R5460:Cd200r3 UTSW 16 44957730 missense possibly damaging 0.66
R6109:Cd200r3 UTSW 16 44953682 missense probably benign 0.02
R8071:Cd200r3 UTSW 16 44954140 missense probably damaging 1.00
R8110:Cd200r3 UTSW 16 44951472 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGCCAGGTAAGCCACATACTG -3'
(R):5'- TTGGCCACATTTGTCACAAACAG -3'

Sequencing Primer
(F):5'- GAGGTGCATCATCTCTGACTGAAC -3'
(R):5'- TTCTTCTTTTTAAAAATGGGGCAGG -3'
Posted On2015-08-18