Incidental Mutation 'R0212:Ift80'
ID 33521
Institutional Source Beutler Lab
Gene Symbol Ift80
Ensembl Gene ENSMUSG00000027778
Gene Name intraflagellar transport 80
Synonyms 4921524P20Rik, Wdr56
MMRRC Submission 038463-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R0212 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 68892499-69004570 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 68940173 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 330 (L330H)
Ref Sequence ENSEMBL: ENSMUSP00000133263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000169064]
AlphaFold Q8K057
Predicted Effect probably benign
Transcript: ENSMUST00000029347
AA Change: L330H

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: L330H

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107812
AA Change: L330H

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: L330H

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152502
Predicted Effect probably benign
Transcript: ENSMUST00000169064
AA Change: L330H

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: L330H

DomainStartEndE-ValueType
WD40 4 41 1.43e0 SMART
Blast:WD40 46 93 4e-9 BLAST
WD40 95 134 9.38e-5 SMART
WD40 136 176 2.75e1 SMART
WD40 177 216 1.42e-4 SMART
WD40 219 256 1.56e-1 SMART
WD40 258 297 2.75e1 SMART
low complexity region 429 440 N/A INTRINSIC
Blast:WD40 496 533 4e-18 BLAST
low complexity region 764 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176754
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 G A 5: 35,848,910 probably null Het
Adat1 T A 8: 111,987,208 D113V possibly damaging Het
Arhgap40 T G 2: 158,550,575 L656V probably damaging Het
Atg2a T C 19: 6,246,554 I330T probably damaging Het
Cad A G 5: 31,078,110 D2137G probably damaging Het
Cd8a G A 6: 71,373,649 E33K probably benign Het
Cemip C A 7: 83,973,190 G594C probably damaging Het
Chd6 T A 2: 161,052,847 D31V probably damaging Het
Cmpk1 A T 4: 114,965,019 M111K possibly damaging Het
Crispld2 T G 8: 120,010,631 H40Q probably benign Het
Depdc5 A G 5: 32,912,242 T441A probably benign Het
Dpm1 T C 2: 168,227,494 N5S probably benign Het
Ercc4 A G 16: 13,123,332 probably null Het
Fam83f A T 15: 80,690,578 M229L probably benign Het
Fgd5 A T 6: 91,988,208 D474V probably damaging Het
Fgf21 G T 7: 45,614,102 P184Q probably benign Het
Fry A T 5: 150,496,397 D1008V probably damaging Het
Gjd2 T C 2: 114,011,472 T175A probably benign Het
Gphn C T 12: 78,637,552 T577I probably damaging Het
Ifi207 A T 1: 173,736,398 N18K possibly damaging Het
Ifne T C 4: 88,879,735 R149G possibly damaging Het
Inpp4b A T 8: 81,770,917 H122L probably benign Het
Inpp5e T C 2: 26,408,340 probably null Het
Ism1 T C 2: 139,740,257 L163S probably benign Het
Itga11 T A 9: 62,745,969 V375E probably benign Het
Itpr3 T G 17: 27,089,319 F306V probably damaging Het
Kif19a A T 11: 114,784,910 I403F possibly damaging Het
Klf12 A T 14: 100,022,862 S144T probably benign Het
Lyst C T 13: 13,635,985 H747Y possibly damaging Het
Mccc2 A G 13: 99,954,655 Y445H probably benign Het
Mei1 G A 15: 82,095,931 probably null Het
Metap2 T A 10: 93,861,380 K479N probably damaging Het
Mief2 A T 11: 60,730,667 D62V probably damaging Het
Mtrf1 A G 14: 79,419,279 D407G probably benign Het
Myo3a A G 2: 22,291,848 R210G probably damaging Het
Nkx2-2 T C 2: 147,184,170 H216R probably damaging Het
Nos1 A G 5: 117,910,212 E694G possibly damaging Het
Nptn A T 9: 58,627,881 Y103F probably benign Het
Nrxn1 A G 17: 90,362,758 probably benign Het
Numbl T C 7: 27,280,759 S389P probably damaging Het
Olfr1155 A G 2: 87,943,091 F179S probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr152 C T 2: 87,783,482 P314L unknown Het
Olfr357 A T 2: 36,997,323 D171V probably damaging Het
Olfr357 T A 2: 36,997,632 V274E possibly damaging Het
Olfr44 C A 9: 39,485,088 S55I probably damaging Het
Olfr975 A G 9: 39,949,940 V277A probably benign Het
Osm T G 11: 4,238,465 S31A probably benign Het
Paqr4 T C 17: 23,738,320 M70V probably benign Het
Pikfyve T A 1: 65,262,905 Y1607N probably benign Het
Plec A C 15: 76,191,305 Y402* probably null Het
Polq A G 16: 37,066,854 K1631E probably damaging Het
Pou6f1 A G 15: 100,580,815 V129A possibly damaging Het
Prm2 A G 16: 10,791,599 probably benign Het
Prtn3 A G 10: 79,881,137 Y112C probably damaging Het
Qrfp T A 2: 31,808,785 H45L probably benign Het
Rps6ka5 A T 12: 100,553,169 probably null Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Slc10a1 A C 12: 80,967,712 L78R possibly damaging Het
Slc26a5 A T 5: 21,823,549 Y340* probably null Het
Sptbn2 T C 19: 4,746,942 probably null Het
St3gal6 C A 16: 58,473,453 A238S probably damaging Het
St3gal6 G T 16: 58,473,455 A237E probably damaging Het
Tmem131l A T 3: 83,913,268 S1226T probably benign Het
Togaram2 C T 17: 71,724,983 L866F probably damaging Het
Txndc17 A G 11: 72,207,732 T37A probably benign Het
Vmn2r105 C A 17: 20,208,565 V750F possibly damaging Het
Vmn2r54 T A 7: 12,632,497 Y170F probably benign Het
Wrnip1 T C 13: 32,821,906 V577A probably benign Het
Zc3h7b A G 15: 81,776,328 T226A probably benign Het
Zfp948 T C 17: 21,588,160 I538T probably benign Het
Zzef1 A G 11: 72,873,910 E1401G possibly damaging Het
Other mutations in Ift80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ift80 APN 3 68914653 nonsense probably null
IGL01020:Ift80 APN 3 68963679 missense probably damaging 1.00
IGL01544:Ift80 APN 3 68990782 missense probably benign 0.05
IGL01612:Ift80 APN 3 68963663 missense possibly damaging 0.61
IGL01743:Ift80 APN 3 68962296 missense probably benign 0.00
IGL02187:Ift80 APN 3 68985456 missense probably damaging 1.00
IGL02381:Ift80 APN 3 68962320 splice site probably null
IGL02407:Ift80 APN 3 68898536 missense probably benign
IGL02510:Ift80 APN 3 68898543 missense probably benign 0.07
IGL02512:Ift80 APN 3 68927725 critical splice donor site probably null
R0091:Ift80 UTSW 3 68914675 missense probably damaging 1.00
R0348:Ift80 UTSW 3 68935899 missense probably benign
R0357:Ift80 UTSW 3 68914653 nonsense probably null
R1381:Ift80 UTSW 3 68914783 missense possibly damaging 0.78
R1419:Ift80 UTSW 3 68940198 missense probably damaging 1.00
R1643:Ift80 UTSW 3 68916157 missense probably benign 0.06
R1899:Ift80 UTSW 3 68918513 missense probably benign 0.00
R1926:Ift80 UTSW 3 68916165 missense probably damaging 1.00
R2013:Ift80 UTSW 3 68990784 missense possibly damaging 0.62
R3894:Ift80 UTSW 3 68917999 missense probably damaging 1.00
R4214:Ift80 UTSW 3 68990808 missense possibly damaging 0.64
R4290:Ift80 UTSW 3 68963690 missense probably damaging 0.96
R4303:Ift80 UTSW 3 68894174 missense probably benign 0.15
R4361:Ift80 UTSW 3 68963649 missense probably damaging 1.00
R4576:Ift80 UTSW 3 68950530 missense possibly damaging 0.71
R4596:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4652:Ift80 UTSW 3 68914940 missense probably benign 0.32
R4654:Ift80 UTSW 3 68918537 missense possibly damaging 0.94
R4720:Ift80 UTSW 3 68962290 missense possibly damaging 0.50
R4865:Ift80 UTSW 3 68990759 missense probably benign 0.01
R4885:Ift80 UTSW 3 68950496 missense probably damaging 0.98
R5357:Ift80 UTSW 3 68990780 missense possibly damaging 0.62
R5561:Ift80 UTSW 3 68967863 missense probably benign 0.00
R5589:Ift80 UTSW 3 68930900 missense probably damaging 1.00
R5806:Ift80 UTSW 3 68950476 missense probably benign 0.09
R6910:Ift80 UTSW 3 68927735 missense probably benign 0.01
R6962:Ift80 UTSW 3 68994545 start gained probably benign
R7157:Ift80 UTSW 3 68990944 nonsense probably null
R7452:Ift80 UTSW 3 68994282 splice site probably null
R7504:Ift80 UTSW 3 68918005 missense probably damaging 0.99
R8077:Ift80 UTSW 3 68916145 missense probably benign 0.01
R8435:Ift80 UTSW 3 68985454 missense probably damaging 1.00
R8821:Ift80 UTSW 3 68962250 missense probably damaging 0.98
R8831:Ift80 UTSW 3 68962250 missense probably damaging 0.98
R8897:Ift80 UTSW 3 68950476 missense probably benign
R9222:Ift80 UTSW 3 68918561 missense possibly damaging 0.58
R9328:Ift80 UTSW 3 68940150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGGACTTTGACTTACGACTC -3'
(R):5'- CGCTTGGCTTGGCATGAAGATG -3'

Sequencing Primer
(F):5'- AGTCTTCCCTCCTATGTAAGGAAAC -3'
(R):5'- GAGCACATTGAATTTTTCCTGCA -3'
Posted On 2013-05-09