Mutagenetix > Incidental Mutation

Incidental Mutation 'R0212:Depdc5'

33529

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

MMRRC Submission

038463-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32912242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 441 (T441A)

Ref Sequence

ENSEMBL: ENSMUSP00000085207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]

AlphaFold

P61460

Predicted Effect

probably benign
Transcript: ENSMUST00000049780
AA Change: T441A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: T441A

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087897
AA Change: T441A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: T441A

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119705
AA Change: T441A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: T441A

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120902
AA Change: T441A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: T441A

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158455

Predicted Effect

probably benign
Transcript: ENSMUST00000195980

SMART Domains

Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	147	4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201802

Predicted Effect

probably benign
Transcript: ENSMUST00000201836

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	G	A	5: 35,848,910		probably null	Het
Adat1	T	A	8: 111,987,208	D113V	possibly damaging	Het
Arhgap40	T	G	2: 158,550,575	L656V	probably damaging	Het
Atg2a	T	C	19: 6,246,554	I330T	probably damaging	Het
Cad	A	G	5: 31,078,110	D2137G	probably damaging	Het
Cd8a	G	A	6: 71,373,649	E33K	probably benign	Het
Cemip	C	A	7: 83,973,190	G594C	probably damaging	Het
Chd6	T	A	2: 161,052,847	D31V	probably damaging	Het
Cmpk1	A	T	4: 114,965,019	M111K	possibly damaging	Het
Crispld2	T	G	8: 120,010,631	H40Q	probably benign	Het
Dpm1	T	C	2: 168,227,494	N5S	probably benign	Het
Ercc4	A	G	16: 13,123,332		probably null	Het
Fam83f	A	T	15: 80,690,578	M229L	probably benign	Het
Fgd5	A	T	6: 91,988,208	D474V	probably damaging	Het
Fgf21	G	T	7: 45,614,102	P184Q	probably benign	Het
Fry	A	T	5: 150,496,397	D1008V	probably damaging	Het
Gjd2	T	C	2: 114,011,472	T175A	probably benign	Het
Gphn	C	T	12: 78,637,552	T577I	probably damaging	Het
Ifi207	A	T	1: 173,736,398	N18K	possibly damaging	Het
Ifne	T	C	4: 88,879,735	R149G	possibly damaging	Het
Ift80	A	T	3: 68,940,173	L330H	probably benign	Het
Inpp4b	A	T	8: 81,770,917	H122L	probably benign	Het
Inpp5e	T	C	2: 26,408,340		probably null	Het
Ism1	T	C	2: 139,740,257	L163S	probably benign	Het
Itga11	T	A	9: 62,745,969	V375E	probably benign	Het
Itpr3	T	G	17: 27,089,319	F306V	probably damaging	Het
Kif19a	A	T	11: 114,784,910	I403F	possibly damaging	Het
Klf12	A	T	14: 100,022,862	S144T	probably benign	Het
Lyst	C	T	13: 13,635,985	H747Y	possibly damaging	Het
Mccc2	A	G	13: 99,954,655	Y445H	probably benign	Het
Mei1	G	A	15: 82,095,931		probably null	Het
Metap2	T	A	10: 93,861,380	K479N	probably damaging	Het
Mief2	A	T	11: 60,730,667	D62V	probably damaging	Het
Mtrf1	A	G	14: 79,419,279	D407G	probably benign	Het
Myo3a	A	G	2: 22,291,848	R210G	probably damaging	Het
Nkx2-2	T	C	2: 147,184,170	H216R	probably damaging	Het
Nos1	A	G	5: 117,910,212	E694G	possibly damaging	Het
Nptn	A	T	9: 58,627,881	Y103F	probably benign	Het
Nrxn1	A	G	17: 90,362,758		probably benign	Het
Numbl	T	C	7: 27,280,759	S389P	probably damaging	Het
Olfr1155	A	G	2: 87,943,091	F179S	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr152	C	T	2: 87,783,482	P314L	unknown	Het
Olfr357	A	T	2: 36,997,323	D171V	probably damaging	Het
Olfr357	T	A	2: 36,997,632	V274E	possibly damaging	Het
Olfr44	C	A	9: 39,485,088	S55I	probably damaging	Het
Olfr975	A	G	9: 39,949,940	V277A	probably benign	Het
Osm	T	G	11: 4,238,465	S31A	probably benign	Het
Paqr4	T	C	17: 23,738,320	M70V	probably benign	Het
Pikfyve	T	A	1: 65,262,905	Y1607N	probably benign	Het
Plec	A	C	15: 76,191,305	Y402*	probably null	Het
Polq	A	G	16: 37,066,854	K1631E	probably damaging	Het
Pou6f1	A	G	15: 100,580,815	V129A	possibly damaging	Het
Prm2	A	G	16: 10,791,599		probably benign	Het
Prtn3	A	G	10: 79,881,137	Y112C	probably damaging	Het
Qrfp	T	A	2: 31,808,785	H45L	probably benign	Het
Rps6ka5	A	T	12: 100,553,169		probably null	Het
Rspo1	G	A	4: 124,991,397	R22Q	probably benign	Het
Slc10a1	A	C	12: 80,967,712	L78R	possibly damaging	Het
Slc26a5	A	T	5: 21,823,549	Y340*	probably null	Het
Sptbn2	T	C	19: 4,746,942		probably null	Het
St3gal6	C	A	16: 58,473,453	A238S	probably damaging	Het
St3gal6	G	T	16: 58,473,455	A237E	probably damaging	Het
Tmem131l	A	T	3: 83,913,268	S1226T	probably benign	Het
Togaram2	C	T	17: 71,724,983	L866F	probably damaging	Het
Txndc17	A	G	11: 72,207,732	T37A	probably benign	Het
Vmn2r105	C	A	17: 20,208,565	V750F	possibly damaging	Het
Vmn2r54	T	A	7: 12,632,497	Y170F	probably benign	Het
Wrnip1	T	C	13: 32,821,906	V577A	probably benign	Het
Zc3h7b	A	G	15: 81,776,328	T226A	probably benign	Het
Zfp948	T	C	17: 21,588,160	I538T	probably benign	Het
Zzef1	A	G	11: 72,873,910	E1401G	possibly damaging	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
alligator	UTSW	5	32964507	splice site	probably null
lagarto	UTSW	5	32979508	missense	probably damaging	1.00
sauros	UTSW	5	32986966	missense	possibly damaging	0.92
IGL02988:Depdc5	UTSW	5	32956167	splice site	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0179:Depdc5	UTSW	5	32901574	unclassified	probably benign
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R1997:Depdc5	UTSW	5	32901906	critical splice donor site	probably null
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	splice site	probably null
R2938:Depdc5	UTSW	5	32901621	splice site	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R3967:Depdc5	UTSW	5	32944115	nonsense	probably null
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4535:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6146:Depdc5	UTSW	5	32968731	missense	probably benign	0.01
R6336:Depdc5	UTSW	5	32964507	splice site	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7386:Depdc5	UTSW	5	32927936	missense	probably benign
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8108:Depdc5	UTSW	5	32945049	missense	probably benign	0.01
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8213:Depdc5	UTSW	5	32937637	missense	probably damaging	1.00
R8382:Depdc5	UTSW	5	32927898	missense	probably benign	0.00
R8680:Depdc5	UTSW	5	32944038	missense	possibly damaging	0.48
R8743:Depdc5	UTSW	5	32924243	missense	probably benign	0.10
R8754:Depdc5	UTSW	5	32979537	missense	probably benign	0.00
R9157:Depdc5	UTSW	5	32945108	missense	probably damaging	0.98
R9364:Depdc5	UTSW	5	32964732	missense	probably benign
R9441:Depdc5	UTSW	5	32937698	missense	probably benign	0.03
R9450:Depdc5	UTSW	5	32934010	missense	probably benign
R9459:Depdc5	UTSW	5	32990773	missense	probably damaging	0.99
R9554:Depdc5	UTSW	5	32964732	missense	probably benign
R9569:Depdc5	UTSW	5	32867977	missense	probably damaging	0.98
R9647:Depdc5	UTSW	5	32924223	missense	possibly damaging	0.94
R9688:Depdc5	UTSW	5	32897932	nonsense	probably null
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AGGTACGTGACTTCAGCAAACCC -3'
(R):5'- ACTGCCGCTTACAAGGTACAAAGG -3'

Sequencing Primer
(F):5'- tggaggaatgctgctgttg -3'
(R):5'- TACAAAGGGGCTAAGAACCTTC -3'

Posted On

2013-05-09