Mutagenetix > Incidental Mutations

Incidental Mutation 'R7452:Ift80'

605533

Institutional Source

Beutler Lab

Gene Symbol

Ift80

Ensembl Gene

ENSMUSG00000027778

Gene Name

intraflagellar transport 80

Synonyms

4921524P20Rik, Wdr56

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R7452 (G1)

Quality Score

52.0072

Status

Validated

Chromosome

Chromosomal Location

68892499-69004570 bp(-) (GRCm38)

Type of Mutation

intron (217 bp from exon)

DNA Base Change (assembly)

T to C at 68994282 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133263 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000148031] [ENSMUST00000154741] [ENSMUST00000169064]

Predicted Effect

probably null
Transcript: ENSMUST00000029347

SMART Domains

Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107812

SMART Domains

Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000148031

SMART Domains

Protein: ENSMUSP00000122919
Gene: ENSMUSG00000027778

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	3e-10	BLAST
WD40	95	134	9.38e-5	SMART
Blast:WD40	136	159	1e-8	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000154741

SMART Domains

Protein: ENSMUSP00000118406
Gene: ENSMUSG00000027778

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	9e-10	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	209	2.12e2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169064

SMART Domains

Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,671	S595P	probably benign	Het
A2m	C	A	6: 121,641,332	Q195K	probably damaging	Het
Abcg4	C	T	9: 44,279,600	G249R	probably damaging	Het
Actn1	T	C	12: 80,183,602	T293A	probably benign	Het
Adamts5	T	A	16: 85,877,981	T432S	probably benign	Het
Adh5	A	G	3: 138,454,745	T347A	probably benign	Het
Agbl5	A	G	5: 30,893,391	D432G	probably damaging	Het
Ank3	A	G	10: 69,899,051	T797A	possibly damaging	Het
Aoc1	T	G	6: 48,908,790	V743G	probably benign	Het
Arap2	A	T	5: 62,676,549	S858R	probably benign	Het
Arid1a	A	C	4: 133,753,127	V162G	possibly damaging	Het
Armc9	A	G	1: 86,213,092	D588G	possibly damaging	Het
Art3	A	G	5: 92,392,680	Y94C	probably damaging	Het
Btaf1	T	A	19: 36,969,127	D444E	probably damaging	Het
Cav2	A	G	6: 17,282,076	H111R	probably damaging	Het
Ccdc148	A	G	2: 58,827,584	L469P	probably damaging	Het
Celsr2	T	A	3: 108,413,090	E802V	possibly damaging	Het
Cfap57	T	C	4: 118,595,784	D574G	probably damaging	Het
Chd7	A	C	4: 8,854,731	D2024A	probably benign	Het
Corin	T	A	5: 72,435,247	D269V	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,598	I359F	probably damaging	Het
Defb6	T	C	8: 19,225,524	L7P	probably damaging	Het
Dnah7c	A	T	1: 46,647,036	M1817L	possibly damaging	Het
Dock3	A	G	9: 106,989,465	F682S	probably damaging	Het
Enpep	T	A	3: 129,271,403	Y879F	possibly damaging	Het
Enpp2	T	C	15: 54,866,736	N462S	probably damaging	Het
Ephb3	T	C	16: 21,217,357		probably null	Het
F7	C	T	8: 13,035,215	H414Y	probably benign	Het
Fbn1	T	C	2: 125,505,455	H50R	possibly damaging	Het
Fig4	T	C	10: 41,240,637	D586G	possibly damaging	Het
Fryl	A	G	5: 73,023,988	L2825P	probably damaging	Het
Gal3st2	T	A	1: 93,872,518	H30Q	possibly damaging	Het
Gm12886	G	A	4: 121,417,474	Q70*	probably null	Het
Gm8104	A	C	14: 43,110,044	T190P	probably benign	Het
Hps3	A	T	3: 20,011,428	N749K	probably damaging	Het
Hr	A	G	14: 70,571,486	T1101A	probably damaging	Het
Htatip2	T	A	7: 49,773,326	S210T	probably benign	Het
Iqgap1	A	G	7: 80,760,829	V212A	possibly damaging	Het
Itih5	A	G	2: 10,238,796	E448G	probably damaging	Het
Kdm5b	T	C	1: 134,624,948	C1221R	probably damaging	Het
Lrrc72	T	C	12: 36,212,693	Y52C	probably benign	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mdn1	T	C	4: 32,739,030	I3617T	possibly damaging	Het
Mtpap	T	A	18: 4,379,705	H98Q	possibly damaging	Het
Nemf	A	T	12: 69,337,959		probably null	Het
Neto1	A	T	18: 86,498,931	I458L	probably benign	Het
Nfam1	T	A	15: 83,014,962	M128L	probably benign	Het
Olfr1279	A	G	2: 111,306,921	T239A	probably damaging	Het
Olfr1383	C	A	11: 49,524,381	H219Q	probably benign	Het
Olfr501-ps1	C	T	7: 108,508,593	T179I	unknown	Het
Olfr914	A	T	9: 38,607,088	I208F	probably benign	Het
P2ry14	C	T	3: 59,116,045	G7D	probably benign	Het
Pde11a	A	G	2: 76,136,414	Y564H	probably damaging	Het
Pex5l	C	T	3: 33,004,318	V262I	probably benign	Het
Poli	A	G	18: 70,508,978	V717A	possibly damaging	Het
Prdm14	A	T	1: 13,125,559	W93R	probably damaging	Het
Rbm46	T	C	3: 82,864,121	M396V	probably benign	Het
Rcor2	T	C	19: 7,271,222	V212A	probably benign	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Skp2	T	A	15: 9,113,832	Q366L	probably damaging	Het
Slc13a3	A	T	2: 165,427,114	S312T	probably benign	Het
Sstr1	T	C	12: 58,213,356	L255P	probably damaging	Het
Steap3	T	C	1: 120,227,855	E458G	possibly damaging	Het
Sv2b	T	A	7: 75,147,713	D311V	probably damaging	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	A	G	8: 70,177,488	D108G	probably damaging	Het
Traf5	T	A	1: 191,999,831	I47F		Het
Trp53bp2	C	T	1: 182,446,568	Q95*	probably null	Het
Ttn	G	T	2: 76,877,143		probably null	Het
Usf3	T	C	16: 44,220,034	S1626P	probably benign	Het
Usp3	T	C	9: 66,566,898	R33G	probably benign	Het
Zbtb20	G	T	16: 43,610,676	A517S	probably damaging	Het

Other mutations in Ift80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Ift80	APN	3	68914653	nonsense	probably null
IGL01020:Ift80	APN	3	68963679	missense	probably damaging	1.00
IGL01544:Ift80	APN	3	68990782	missense	probably benign	0.05
IGL01612:Ift80	APN	3	68963663	missense	possibly damaging	0.61
IGL01743:Ift80	APN	3	68962296	missense	probably benign	0.00
IGL02187:Ift80	APN	3	68985456	missense	probably damaging	1.00
IGL02381:Ift80	APN	3	68962320	unclassified	probably null
IGL02407:Ift80	APN	3	68898536	missense	probably benign
IGL02510:Ift80	APN	3	68898543	missense	probably benign	0.07
IGL02512:Ift80	APN	3	68927725	critical splice donor site	probably null
R0091:Ift80	UTSW	3	68914675	missense	probably damaging	1.00
R0212:Ift80	UTSW	3	68940173	missense	probably benign	0.05
R0348:Ift80	UTSW	3	68935899	missense	probably benign
R0357:Ift80	UTSW	3	68914653	nonsense	probably null
R1381:Ift80	UTSW	3	68914783	missense	possibly damaging	0.78
R1419:Ift80	UTSW	3	68940198	missense	probably damaging	1.00
R1643:Ift80	UTSW	3	68916157	missense	probably benign	0.06
R1899:Ift80	UTSW	3	68918513	missense	probably benign	0.00
R1926:Ift80	UTSW	3	68916165	missense	probably damaging	1.00
R2013:Ift80	UTSW	3	68990784	missense	possibly damaging	0.62
R3894:Ift80	UTSW	3	68917999	missense	probably damaging	1.00
R4214:Ift80	UTSW	3	68990808	missense	possibly damaging	0.64
R4290:Ift80	UTSW	3	68963690	missense	probably damaging	0.96
R4303:Ift80	UTSW	3	68894174	missense	probably benign	0.15
R4361:Ift80	UTSW	3	68963649	missense	probably damaging	1.00
R4576:Ift80	UTSW	3	68950530	missense	possibly damaging	0.71
R4596:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4652:Ift80	UTSW	3	68914940	missense	probably benign	0.32
R4654:Ift80	UTSW	3	68918537	missense	possibly damaging	0.94
R4720:Ift80	UTSW	3	68962290	missense	possibly damaging	0.50
R4865:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4885:Ift80	UTSW	3	68950496	missense	probably damaging	0.98
R5357:Ift80	UTSW	3	68990780	missense	possibly damaging	0.62
R5561:Ift80	UTSW	3	68967863	missense	probably benign	0.00
R5589:Ift80	UTSW	3	68930900	missense	probably damaging	1.00
R5806:Ift80	UTSW	3	68950476	missense	probably benign	0.09
R6910:Ift80	UTSW	3	68927735	missense	probably benign	0.01
R6962:Ift80	UTSW	3	68994545	start gained	probably benign
R7157:Ift80	UTSW	3	68990944	nonsense	probably null
R7504:Ift80	UTSW	3	68918005	missense	probably damaging	0.99
R8077:Ift80	UTSW	3	68916145	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGAATGATTGCTGCCTTCC -3'
(R):5'- GGCCATACCGTCAAGTTCTC -3'

Sequencing Primer
(F):5'- TGAACTCAGAAGTCTGCCTG -3'
(R):5'- GCCATACCGTCAAGTTCTCTTCTG -3'

Posted On

2019-12-11