Incidental Mutation 'R0230:Zfp457'
ID34076
Institutional Source Beutler Lab
Gene Symbol Zfp457
Ensembl Gene ENSMUSG00000055341
Gene Namezinc finger protein 457
SynonymsRslcan-6
MMRRC Submission 038473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0230 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67288138-67306485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67294116 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 132 (T132A)
Ref Sequence ENSEMBL: ENSMUSP00000053879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049705] [ENSMUST00000224325]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049705
AA Change: T132A

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053879
Gene: ENSMUSG00000055341
AA Change: T132A

DomainStartEndE-ValueType
KRAB 5 65 1.55e-29 SMART
ZnF_C2H2 81 103 2.75e-3 SMART
ZnF_C2H2 109 131 1.1e-2 SMART
ZnF_C2H2 165 187 3.63e-3 SMART
ZnF_C2H2 193 215 2.4e-3 SMART
ZnF_C2H2 221 243 1.12e-3 SMART
ZnF_C2H2 249 271 6.32e-3 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 3.89e-3 SMART
ZnF_C2H2 361 383 7.26e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 7.67e-2 SMART
ZnF_C2H2 445 467 1.05e1 SMART
ZnF_C2H2 473 495 3.11e-2 SMART
ZnF_C2H2 501 523 5.9e-3 SMART
ZnF_C2H2 529 551 9.08e-4 SMART
ZnF_C2H2 585 607 5.72e-1 SMART
transmembrane domain 624 646 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224325
AA Change: T36A

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225090
Predicted Effect probably benign
Transcript: ENSMUST00000225338
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,156,825 H2012Q probably damaging Het
Amy1 T C 3: 113,558,430 D371G probably benign Het
Asrgl1 T A 19: 9,118,519 probably benign Het
Asxl3 T A 18: 22,452,326 probably benign Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Bbof1 A G 12: 84,425,204 H74R probably damaging Het
Bpifb9b C T 2: 154,317,075 T504M probably damaging Het
Cdk12 T G 11: 98,203,991 S208R probably damaging Het
Cdk5r1 T C 11: 80,477,750 L81P probably damaging Het
Chrd T C 16: 20,733,275 L43P probably benign Het
Col6a4 A C 9: 106,072,366 M690R probably benign Het
Cyp39a1 A T 17: 43,732,012 R418W probably damaging Het
Dars2 C T 1: 161,062,787 V162M probably benign Het
Dixdc1 C T 9: 50,695,507 V270M possibly damaging Het
Dnah11 C A 12: 117,983,056 E1194* probably null Het
Dnah7b T C 1: 46,219,348 S1900P probably damaging Het
Dnah9 C T 11: 65,855,315 E3991K probably damaging Het
Dsp A T 13: 38,197,705 I2210F probably benign Het
Ebf1 A G 11: 44,996,122 S556G probably damaging Het
Enam G A 5: 88,489,655 probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Epc1 T C 18: 6,440,168 D579G probably damaging Het
Ephb3 A T 16: 21,220,775 I426F probably damaging Het
Fam135b T G 15: 71,446,037 I1359L probably benign Het
Gm16519 T C 17: 70,929,133 S26P probably benign Het
Gm17622 T A 13: 96,491,086 probably null Het
Gpat2 G A 2: 127,435,845 V764I possibly damaging Het
Gpx4 G A 10: 80,055,004 A81T probably benign Het
Gss C A 2: 155,578,406 R83L probably damaging Het
Hcls1 C A 16: 36,937,854 Q36K probably damaging Het
Hepacam2 A G 6: 3,463,336 V438A probably benign Het
Hnf4a T C 2: 163,559,085 F184S probably damaging Het
Katnal1 T A 5: 148,918,650 D90V possibly damaging Het
Kcnt2 A G 1: 140,246,345 D30G probably benign Het
Kyat1 T C 2: 30,194,075 E11G probably benign Het
Lefty1 T A 1: 180,937,014 V168E probably damaging Het
Map2k6 C T 11: 110,496,455 P218S probably damaging Het
Mlkl C G 8: 111,315,062 K415N probably benign Het
Myh7 A T 14: 54,973,933 M1593K probably benign Het
Myo19 T A 11: 84,893,333 C186S possibly damaging Het
Ngp T C 9: 110,420,001 L47P probably damaging Het
Nkiras1 A G 14: 18,280,185 N192S probably benign Het
Olfr1044 T C 2: 86,171,542 I92V probably benign Het
Olfr134 A G 17: 38,175,950 I289V probably damaging Het
Olfr346 G A 2: 36,688,616 V205M probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pdcd6ip A G 9: 113,685,293 probably benign Het
Pde4b T C 4: 102,597,510 Y186H probably benign Het
Pex7 A G 10: 19,904,585 V101A possibly damaging Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Plxnc1 A G 10: 94,799,347 V1339A probably benign Het
Proser1 A G 3: 53,478,962 N755S probably damaging Het
Ptpn13 A G 5: 103,527,131 D658G probably damaging Het
Rassf8 A C 6: 145,819,974 probably benign Het
Rfc4 G A 16: 23,114,099 Q363* probably null Het
Rxfp1 T C 3: 79,644,975 N673S probably damaging Het
Scn7a T C 2: 66,726,284 E319G probably damaging Het
Scnn1g A G 7: 121,746,761 probably benign Het
Scube2 C T 7: 109,824,764 probably null Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc6a13 A G 6: 121,324,303 N184D probably benign Het
Slco1a5 T A 6: 142,236,328 probably benign Het
Slf1 T A 13: 77,112,748 probably benign Het
Smarca4 G A 9: 21,700,872 V1518I probably damaging Het
Smyd3 A G 1: 179,423,428 probably benign Het
Sox5 A G 6: 144,209,338 F11L probably benign Het
Spag17 T C 3: 100,106,827 S2139P probably benign Het
Spice1 A T 16: 44,365,576 probably benign Het
Sptan1 T A 2: 30,010,692 probably benign Het
Srebf2 T A 15: 82,182,085 N571K probably damaging Het
Tbl3 A G 17: 24,701,333 L670P probably damaging Het
Tmem45a2 A G 16: 57,046,996 V114A possibly damaging Het
Tmigd3 A G 3: 105,918,737 N132D possibly damaging Het
Ttn T C 2: 76,737,434 D19378G probably damaging Het
Ugcg C A 4: 59,189,739 Y32* probably null Het
Ush2a C T 1: 188,850,104 P3788L probably damaging Het
Usp22 T A 11: 61,159,197 probably benign Het
Xaf1 T C 11: 72,306,555 probably benign Het
Zbtb41 C T 1: 139,446,935 T711I probably damaging Het
Zfp64 T G 2: 168,912,230 probably benign Het
Other mutations in Zfp457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zfp457 APN 13 67294266 missense possibly damaging 0.46
IGL02259:Zfp457 APN 13 67296407 missense possibly damaging 0.88
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0149:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0270:Zfp457 UTSW 13 67293927 missense probably damaging 1.00
R0361:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0561:Zfp457 UTSW 13 67294070 missense probably damaging 1.00
R0679:Zfp457 UTSW 13 67293591 missense probably damaging 1.00
R0826:Zfp457 UTSW 13 67293314 missense possibly damaging 0.85
R1136:Zfp457 UTSW 13 67293782 missense probably damaging 1.00
R1175:Zfp457 UTSW 13 67293684 missense probably damaging 1.00
R1523:Zfp457 UTSW 13 67293437 missense probably damaging 1.00
R1616:Zfp457 UTSW 13 67296311 missense possibly damaging 0.95
R2348:Zfp457 UTSW 13 67293404 missense probably benign 0.33
R4930:Zfp457 UTSW 13 67294100 missense probably damaging 1.00
R4964:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R4966:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R5040:Zfp457 UTSW 13 67292835 missense probably benign 0.03
R5129:Zfp457 UTSW 13 67293356 missense probably benign 0.00
R5714:Zfp457 UTSW 13 67296426 missense possibly damaging 0.85
R6017:Zfp457 UTSW 13 67293699 missense probably damaging 1.00
R6052:Zfp457 UTSW 13 67293951 missense probably damaging 1.00
R6132:Zfp457 UTSW 13 67293296 nonsense probably null
R6184:Zfp457 UTSW 13 67292912 missense possibly damaging 0.89
R6313:Zfp457 UTSW 13 67292682 missense probably damaging 1.00
R7038:Zfp457 UTSW 13 67293933 missense probably benign 0.00
R7170:Zfp457 UTSW 13 67294177 nonsense probably null
R7184:Zfp457 UTSW 13 67294001 missense possibly damaging 0.69
R7859:Zfp457 UTSW 13 67306381 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ggttttttccctgtatgaaCAATTTTGTGTTG -3'
(R):5'- GGCTTTCACCTATGCTGTGTTGTACTT -3'

Sequencing Primer
(F):5'- attctcttatggttggaaagtcttg -3'
(R):5'- ACTTAGGCTTCAATGAGTACAGATAG -3'
Posted On2013-05-09