Incidental Mutation 'R0561:Zfp457'
Institutional Source Beutler Lab
Gene Symbol Zfp457
Ensembl Gene ENSMUSG00000055341
Gene Namezinc finger protein 457
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0561 (G1)
Quality Score225
Status Not validated
Chromosomal Location67288138-67306485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67294070 bp
Amino Acid Change Histidine to Leucine at position 147 (H147L)
Ref Sequence ENSEMBL: ENSMUSP00000053879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049705] [ENSMUST00000224325]
Predicted Effect probably damaging
Transcript: ENSMUST00000049705
AA Change: H147L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000053879
Gene: ENSMUSG00000055341
AA Change: H147L

KRAB 5 65 1.55e-29 SMART
ZnF_C2H2 81 103 2.75e-3 SMART
ZnF_C2H2 109 131 1.1e-2 SMART
ZnF_C2H2 165 187 3.63e-3 SMART
ZnF_C2H2 193 215 2.4e-3 SMART
ZnF_C2H2 221 243 1.12e-3 SMART
ZnF_C2H2 249 271 6.32e-3 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 3.89e-3 SMART
ZnF_C2H2 361 383 7.26e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 7.67e-2 SMART
ZnF_C2H2 445 467 1.05e1 SMART
ZnF_C2H2 473 495 3.11e-2 SMART
ZnF_C2H2 501 523 5.9e-3 SMART
ZnF_C2H2 529 551 9.08e-4 SMART
ZnF_C2H2 585 607 5.72e-1 SMART
transmembrane domain 624 646 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224325
AA Change: H51L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225090
Predicted Effect probably benign
Transcript: ENSMUST00000225338
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Other mutations in Zfp457
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zfp457 APN 13 67294266 missense possibly damaging 0.46
IGL02259:Zfp457 APN 13 67296407 missense possibly damaging 0.88
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0055:Zfp457 UTSW 13 67294034 missense probably damaging 0.99
R0149:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0211:Zfp457 UTSW 13 67293147 missense probably benign 0.01
R0230:Zfp457 UTSW 13 67294116 missense possibly damaging 0.91
R0270:Zfp457 UTSW 13 67293927 missense probably damaging 1.00
R0361:Zfp457 UTSW 13 67292646 missense probably damaging 0.97
R0679:Zfp457 UTSW 13 67293591 missense probably damaging 1.00
R0826:Zfp457 UTSW 13 67293314 missense possibly damaging 0.85
R1136:Zfp457 UTSW 13 67293782 missense probably damaging 1.00
R1175:Zfp457 UTSW 13 67293684 missense probably damaging 1.00
R1523:Zfp457 UTSW 13 67293437 missense probably damaging 1.00
R1616:Zfp457 UTSW 13 67296311 missense possibly damaging 0.95
R2348:Zfp457 UTSW 13 67293404 missense probably benign 0.33
R4930:Zfp457 UTSW 13 67294100 missense probably damaging 1.00
R4964:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R4966:Zfp457 UTSW 13 67293278 missense probably damaging 1.00
R5040:Zfp457 UTSW 13 67292835 missense probably benign 0.03
R5129:Zfp457 UTSW 13 67293356 missense probably benign 0.00
R5714:Zfp457 UTSW 13 67296426 missense possibly damaging 0.85
R6017:Zfp457 UTSW 13 67293699 missense probably damaging 1.00
R6052:Zfp457 UTSW 13 67293951 missense probably damaging 1.00
R6132:Zfp457 UTSW 13 67293296 nonsense probably null
R6184:Zfp457 UTSW 13 67292912 missense possibly damaging 0.89
R6313:Zfp457 UTSW 13 67292682 missense probably damaging 1.00
R7038:Zfp457 UTSW 13 67293933 missense probably benign 0.00
R7170:Zfp457 UTSW 13 67294177 nonsense probably null
R7184:Zfp457 UTSW 13 67294001 missense possibly damaging 0.69
R7859:Zfp457 UTSW 13 67306381 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ggttttttccctgtatgaaCAATTTTGTGTTG -3'

Sequencing Primer
(F):5'- attctcttatggttggaaagtcttg -3'
(R):5'- catgcaaagaatgtggcaaag -3'
Posted On2013-06-11